Stem-loop sequence gma-MIR9760

AccessionMI0031057 (change log)
DescriptionGlycine max miR9760 stem-loop
Stem-loop
   c                   c         a     ugcaa        ag  -  uu     cccuuguuaagcacauccaagagaccaagacuaaauu 
5'  cucaacaaucaaaacuaca cauccagaa aagca     uuagggau  uc ga  guaug                                     a
    ||||||||||||||||||| ||||||||| |||||     ||||||||  || ||  |||||                                      
3'  gaguuguuaguuuugaugu guaggucuu uucgu     aauccuua  gg cu  cauau                                     a
   -                   a         c     -ucug        aa  a  uu     ccugauguaguuccggguuggaaaucaagaauggaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 38654713-38654911 [-]
intergenic
Database links

Mature sequence gma-miR9760

Accession MIMAT0036395
Sequence

174 - 

uggaugauguaguuuugauug

 - 194

Get sequence
Evidence experimental; Illumina [1]

References

1