Stem-loop sequence ggo-mir-1283-1

AccessionMI0031084 (change log)
DescriptionGorilla gorilla miR-1283-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -ugcuggagcaagaaga                u            c      guug  a 
5'                  ucucaggcugugacuc gcaaagggaagc cuuucu    uc g
                    |||||||||||||||| |||||||||||| ||||||    || a
3'                  agaguuuggcauuggg cguuucccuucg gaaaga    ag a
   guugaaguugcagcgaa                u            c      --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr19: 53081305-53081424 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-1283-1
ggo-mir-517c-2chr19: 53063883-53063997 [+]
ggo-mir-518echr19: 53073319-53073416 [+]
ggo-mir-518dchr19: 53078317-53078435 [+]
ggo-mir-516b-1chr19: 53080303-53080412 [+]
ggo-mir-1283-1chr19: 53081305-53081424 [+]
ggo-mir-517c-2chr19: 53083310-53083424 [+]
ggo-mir-520gchr19: 53084517-53084631 [+]
Database links

Mature sequence ggo-miR-1283

Accession MIMAT0036431
Sequence

32 - 

cugcaaagggaagcccuuuc

 - 51

Get sequence
Evidence not experimental

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).