Stem-loop sequence ptr-mir-518g

AccessionMI0031109 (change log)
DescriptionPan troglodytes miR-518g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   aagaaga     u        u  g           c         g c 
5'        ucucg gcugugac cu caaagggaagc cuuucuguu u u
          ||||| |||||||| || ||||||||||| ||||||||| | a
3'        agagu uggcauug ga guuucccuucg gaaagauaa a a
   ----aaa     u        u  g           c         g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56078436-56078532 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-518g
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
ptr-mir-518echr19: 56077248-56077334 [+]
ptr-mir-518gchr19: 56078436-56078532 [+]
ptr-mir-518dchr19: 56082272-56082357 [+]
ptr-mir-516b-1chr19: 56084257-56084345 [+]
ptr-mir-518achr19: 56086733-56086818 [+]
Database links

Mature sequence ptr-miR-518g-5p

Accession MIMAT0036454
Sequence

23 - 

cugcaaagggaagcccuuuc

 - 42

Get sequence
Evidence not experimental
Predicted targets

Mature sequence ptr-miR-518g-3p

Accession MIMAT0036455
Sequence

60 - 

gaaagcgcuucccuuuggagug

 - 81

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).