Stem-loop sequence ptr-mir-1283b

AccessionMI0031111 (change log)
DescriptionPan troglodytes miR-1283b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   ----cuggagcaagaaga             gu  g           cc     guug  u 
5'                   ucucaggcuguga  cu caaagggaagc  uuucu    uc g
                     |||||||||||||  || |||||||||||  |||||    || a
3'                   agaguuuggcauu  ga guuucccuucg  aaaga    ag a
   guugaaguugcgacgaaa             gu  g           cu     --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56105638-56105756 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-1283b
ptr-mir-521-1chr19: 56096062-56096147 [+]
ptr-mir-522chr19: 56098628-56098713 [+]
ptr-mir-519fchr19: 56099801-56099908 [+]
ptr-mir-527chr19: 56101441-56101526 [+]
ptr-mir-516a-1chr19: 56104159-56104247 [+]
ptr-mir-1283bchr19: 56105638-56105756 [+]
ptr-mir-516a-2chr19: 56108558-56108646 [+]
ptr-mir-519achr19: 56109768-56109853 [+]
Database links

Mature sequence ptr-miR-1283b

Accession MIMAT0036458
Sequence

30 - 

cugcaaagggaagcccuuuc

 - 49

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).