Stem-loop sequence tch-mir-200a

AccessionMI0031125 (change log)
DescriptionTupaia chinensis miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop 
   --    -             c    -  uc 
5'   cauc uuaccggacagug ugga cu  u
     |||| ||||||||||||| |||| ||  c
3'   guag aauggucugucac aucu gg  a
   uu    c             a    c  ca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB364377.1: 9043899-9043957 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-200a
tch-mir-200bKB364377.1: 9043059-9043116 [+]
tch-mir-200aKB364377.1: 9043899-9043957 [+]
Database links

Mature sequence tch-miR-200a-3p

Accession MIMAT0036466
Sequence

37 -  

uaacacugucugguaacgauguu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24314655 "microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture" Xu G, Gao Z, He W, Ma Y, Feng X, Cai T, Lu F, Liu L, Li W Virology. 448:247-254(2014).