Stem-loop sequence tch-mir-32

AccessionMI0031143 (change log)
DescriptionTupaia chinensis miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
   --   ug     u            - uu  c 
5'   uau  cacau acuaaguugcau g  gu a
     |||  ||||| |||||||||||| |  ||  
3'   aua  gugug ugauuuaacgua c  cg c
   uu   gu     -            a uc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320489.1: 121016-121077 [-]
intergenic
Database links

Mature sequence tch-miR-32-5p

Accession MIMAT0036485
Sequence

1 - 

uauugcacauuacuaaguugca

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1