Stem-loop sequence tch-mir-141

AccessionMI0031147 (change log)
DescriptionTupaia chinensis miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   --      --    u        -   ugg  ug 
5'   caucuu  ccag acaguguu gga   uc  a
     ||||||  |||| |||||||| |||   ||  u
3'   guagaa  gguc ugucacaa ccu   ag  c
   cg      au    -        u   cga  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB369804.1: 349690-349754 [-]
intergenic
Clustered miRNAs
< 10kb from tch-mir-141
tch-mir-200cKB369804.1: 350362-350424 [-]
tch-mir-141KB369804.1: 349690-349754 [-]
Database links

Mature sequence tch-miR-141-3p

Accession MIMAT0036489
Sequence

43 - 

uaacacugucugguaaagauggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1