Stem-loop sequence tch-mir-92a-1

AccessionMI0031156 (change log)
DescriptionTupaia chinensis miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --          c   u           uu 
5'   agguugggau ggu gcaaugcugug  u
     |||||||||| ||| |||||||||||   
3'   uccggcccug uca cguuaugguau  u
   ug          u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320410.1: 3473876-3473934 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-92a-1
tch-mir-17KB320410.1: 3473178-3473237 [+]
tch-mir-19aKB320410.1: 3473460-3473518 [+]
tch-mir-20aKB320410.1: 3473624-3473682 [+]
tch-mir-19b-1KB320410.1: 3473759-3473819 [+]
tch-mir-92a-1KB320410.1: 3473876-3473934 [+]
Database links

Mature sequence tch-miR-92a-3p

Accession MIMAT0036500
Sequence

38 - 

uauugcacuugucccggccugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1