Stem-loop sequence tch-mir-381

AccessionMI0031231 (change log)
DescriptionTupaia chinensis miR-381 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   --  c   g        u        --g   c 
5'   ag gag uugcccuu guauguuc   guu a
     || ||| |||||||| ||||||||   |||  
3'   uc cuc aacgggaa cauauaag   cag u
   ug  u   g        -        aua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321140.1: 4906349-4906411 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-381
tch-mir-376cKB321140.1: 4900221-4900278 [+]
tch-mir-376a-1KB321140.1: 4900596-4900653 [+]
tch-mir-376bKB321140.1: 4900972-4901030 [+]
tch-mir-376a-2KB321140.1: 4901294-4901351 [+]
tch-mir-381KB321140.1: 4906349-4906411 [+]
tch-mir-539KB321140.1: 4907685-4907744 [+]
Database links

Mature sequence tch-miR-381-3p

Accession MIMAT0036568
Sequence

42 - 

uauacaagggcaagcucucugu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1