Stem-loop sequence tch-mir-425

AccessionMI0031235 (change log)
DescriptionTupaia chinensis miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   aau       u  c     u  ----ag   g 
5'    gacacga ca ucccg ug      ugg c
      ||||||| || ||||| ||      |||  
3'    cugugcu gu agggc ac      acc a
   cgc       -  a     u  cgaaga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB369979.1: 1119702-1119762 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-425
tch-mir-191KB369979.1: 1119228-1119291 [+]
tch-mir-425KB369979.1: 1119702-1119762 [+]
Database links

Mature sequence tch-miR-425-5p

Accession MIMAT0036572
Sequence

1 - 

aaugacacgaucacucccguuga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1