Stem-loop sequence tch-mir-363

AccessionMI0031252 (change log)
DescriptionTupaia chinensis miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   --         ca  a         --ga   gu 
5'   cggguggau  cg ugcaauuuu    uua  a
     |||||||||  || |||||||||    |||   
3'   gucuaccua  gc acguuaaaa    gau  u
   au         ug  -         agag   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB370352.1: 1650651-1650715 [-]
intergenic
Clustered miRNAs
< 10kb from tch-mir-363
tch-mir-19b-2KB370352.1: 1650949-1651014 [-]
tch-mir-92a-2KB370352.1: 1650812-1650872 [-]
tch-mir-363KB370352.1: 1650651-1650715 [-]
Database links

Mature sequence tch-miR-363-3p

Accession MIMAT0036586
Sequence

44 - 

aauugcacgguauccaucugua

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1