Stem-loop sequence tch-mir-25

AccessionMI0031256 (change log)
DescriptionTupaia chinensis miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --    g     uu g     u   --  ac 
5'   aggc gagac  g gcaau gcu  gg  g
     |||| |||||  | ||||| |||  ||  c
3'   ucug cucug  c cguua cgg  cc  u
   ag    g     uu a     -   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320709.1: 105595-105654 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-25
tch-mir-93KB320709.1: 105392-105453 [+]
tch-mir-25KB320709.1: 105595-105654 [+]
Database links

Mature sequence tch-miR-25-3p

Accession MIMAT0036590
Sequence

39 - 

cauugcacuugucucggucuga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1