Stem-loop sequence tch-mir-1301

AccessionMI0031264 (change log)
DescriptionTupaia chinensis miR-1301 stem-loop
Gene family MIPF0000742; mir-1301
Stem-loop
   --       -     - c      -  gu 
5'   ucacucu aggca c gcagca cu  g
     ||||||| ||||| | |||||| ||  c
3'   agugagg uccgu g cguugu gg  u
   uc       g     c a      a  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB360584.1: 4130296-4130351 [+]
intergenic
Database links

Mature sequence tch-miR-1301

Accession MIMAT0036598
Sequence

35 - 

uugcagcugccugggagugacu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1