Stem-loop sequence tch-mir-9771m

AccessionMI0031265 (change log)
DescriptionTupaia chinensis miR-9771m stem-loop
Stem-loop
   ---         c  c    c      gc 
5'    ucggaaaag ca gaca auuuuu  a
      ||||||||| || |||| ||||||  u
3'    agccuuuuc gu cugu uaaaaa  a
   agu         a  a    a      ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB364833.1: 121813-121870 [+]
intergenic
Database links

Mature sequence tch-miR-9771m

Accession MIMAT0036599
Sequence

37 - 

uaugucaugacuuuuccgauga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1