Stem-loop sequence oha-mir-142

AccessionMI0031355 (change log)
DescriptionOphiophagus hannah miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   -uaugg      g                 a         uaaac     u 
5'       acagug acucauccauaaaguag aagcacuac     gcuug g
         |||||| ||||||||||||||||| |||||||||     |||||  
3'       ugucau ugaguagguauuucauc uuugugaug     ugaac u
   aacgag      g                 c         -----     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01001308.1: 316277-316374 [-]
intergenic
Database links

Mature sequence oha-miR-142-5p

Accession MIMAT0036721
Sequence

20 - 

cauaaaguagaaagcacuacua

 - 41

Get sequence
Evidence not experimental

Mature sequence oha-miR-142-3p

Accession MIMAT0036722
Sequence

58 - 

uguaguguuuccuacuuuaugga

 - 80

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).