Stem-loop sequence oha-mir-143

AccessionMI0031356 (change log)
DescriptionOphiophagus hannah miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   -----  ca  g         g      u  -   g 
5'      cc  ag ugcagugcu caucuc gg uca u
        ||  || ||||||||| |||||| || |||  
3'      gg  uc augucacga guagag cu agu u
   gggaa  ac  g         a      u  g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000254.1: 119771-119838 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-143
oha-mir-143AZIM01000254.1: 119771-119838 [-]
oha-mir-145AZIM01000254.1: 119187-119258 [-]
Database links

Mature sequence oha-miR-143-5p

Accession MIMAT0036723
Sequence

5 - 

aggugcagugcugcaucucuggu

 - 27

Get sequence
Evidence not experimental

Mature sequence oha-miR-143-3p

Accession MIMAT0036724
Sequence

40 - 

ugagaugaagcacuguagcuca

 - 61

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).