Stem-loop sequence oha-mir-204-2

AccessionMI0031405 (change log)
DescriptionOphiophagus hannah miR-204-2 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   ----ccuc ug  cu  g    -u        c     a     gga  u 
5'         a  ac  gc gggu  cccuuugu auccu ugccu   gc c
           |  ||  || ||||  |||||||| ||||| |||||   || a
3'         u  ug  cg cucg  gggaaacg ugggg acgga   ug g
   gcaaucuu gu  -u  a    uc        c     -     --g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000190.1: 1085405-1085498 [+]
intergenic
Database links

Mature sequence oha-miR-204-5p

Accession MIMAT0036812
Sequence

18 - 

uucccuuugucauccuaugccu

 - 39

Get sequence
Evidence not experimental

Mature sequence oha-miR-204-2-3p

Accession MIMAT0036814
Sequence

55 - 

gcaggggucgcaaagggcugc

 - 75

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).