Stem-loop sequence oha-mir-215

AccessionMI0031416 (change log)
DescriptionOphiophagus hannah miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   ------------------      a  a     -  uu      a ugu   a 
5'                   agggua ug ccuau ga  ugacag c   gcu u
                     |||||| || ||||| ||  |||||| |   ||| c
3'                   ucucau ac ggaug cu  acuguc g   uga u
   caucucaucacuuguacg      a  c     u  uu      c -uc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01001511.1: 634812-634900 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-215
oha-mir-194-1AZIM01001511.1: 634495-634574 [+]
oha-mir-215AZIM01001511.1: 634812-634900 [+]
Database links

Mature sequence oha-miR-215-5p

Accession MIMAT0036831
Sequence

7 - 

augaccuaugauuugacagacu

 - 28

Get sequence
Evidence not experimental

Mature sequence oha-miR-215-3p

Accession MIMAT0036832
Sequence

46 - 

cugucauuucuguaggccaaua

 - 67

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).