Stem-loop sequence oha-mir-32-1

AccessionMI0031456 (change log)
DescriptionOphiophagus hannah miR-32-1 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
   cug    u     ug     u            -guu  c 
5'    gugg gauau  cacau acuaaguugcau    gu a
      |||| |||||  ||||| ||||||||||||    ||  
3'    cacu uuaua  gugug ugauuuaacgug    cg c
   -ua    u     gu     -            acuu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01004762.1: 14849-14927 [+]
intergenic
Database links

Mature sequence oha-miR-32-5p

Accession MIMAT0036899
Sequence

11 - 

uauugcacauuacuaaguugcau

 - 33

Get sequence
Evidence not experimental

Mature sequence oha-miR-32-3p

Accession MIMAT0036900
Sequence

52 - 

caauuuagugugugugauauuu

 - 73

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).