Stem-loop sequence oha-mir-363

AccessionMI0031463 (change log)
DescriptionOphiophagus hannah miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   gu   u   gu         ca  a         ga  agau 
5'   ugc guu  cggguggau  cg ugcaauuuu  uu    u
     ||| |||  |||||||||  || |||||||||  ||     
3'   acg caa  gucuaccua  gc acguuaaag  ag    a
   -g   c   au         ug  -         ga  gacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002644.1: 179985-180068 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-363
oha-mir-18bAZIM01002644.1: 177020-177099 [+]
oha-mir-20bAZIM01002644.1: 179551-179635 [+]
oha-mir-92a-2AZIM01002644.1: 179818-179909 [+]
oha-mir-363AZIM01002644.1: 179985-180068 [+]
Database links

Mature sequence oha-miR-363-5p

Accession MIMAT0036912
Sequence

12 - 

cggguggaucacgaugcaauuu

 - 33

Get sequence
Evidence not experimental

Mature sequence oha-miR-363-3p

Accession MIMAT0036913
Sequence

55 - 

aauugcacgguauccaucuguaa

 - 77

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).