Stem-loop sequence oha-mir-425

AccessionMI0031468 (change log)
DescriptionOphiophagus hannah miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   -gga       uu  ca    au       u  cu    c  a  gag  g 
5'     ggagaaa  gc  agga  gacacga ca  cccg ug gc   ug a
       |||||||  ||  ||||  ||||||| ||  |||| || ||   ||  
3'     ccuuuuu  cg  uccu  cugugcu gu  gggc ac cg   ac c
   agaa       --  ag    gu       -  cg    -  -  -ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01001838.1: 344550-344646 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-425
oha-mir-191AZIM01001838.1: 347131-347216 [-]
oha-mir-425AZIM01001838.1: 344550-344646 [-]
oha-mir-2970AZIM01001838.1: 342227-342309 [-]
Database links

Mature sequence oha-miR-425-5p

Accession MIMAT0036921
Sequence

20 - 

aaugacacgaucacucccgcug

 - 41

Get sequence
Evidence not experimental

Mature sequence oha-miR-425-3p

Accession MIMAT0036922
Sequence

62 - 

cggggcugucgugucugucc

 - 81

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).