Stem-loop sequence oha-mir-490

AccessionMI0031476 (change log)
DescriptionOphiophagus hannah miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   acaac    -g     uauguu  u a       c      --         g   caagauu 
5'      gcug  uguga      ca g uucgaca caugga  ucuccaggu ggu       a
        ||||  |||||      || | ||||||| ||||||  ||||||||| |||       u
3'      cgac  acacu      gu c gaguugu guaccu  ggaggucca cca       a
   -agga    ga     -----u  - -       c      ca         a   caaagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000546.1: 118055-118172 [+]
intergenic
Database links

Mature sequence oha-miR-490-5p

Accession MIMAT0036936
Sequence

34 - 

ccauggaucuccaggugggu

 - 53

Get sequence
Evidence not experimental

Mature sequence oha-miR-490-3p

Accession MIMAT0036937
Sequence

73 - 

caaccuggaggacuccaugcugu

 - 95

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).