Stem-loop sequence oha-mir-92a-2

AccessionMI0031492 (change log)
DescriptionOphiophagus hannah miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ucu        -----------          c   u   u   ---     c 
5'    uccucccu           ggguugggau agu gua uac   ucgga g
      ||||||||           |||||||||| ||| ||| |||   |||||  
3'    aggagggg           uccggcccug uca cgu aug   agucu u
   -cc        agugggaggug          u   -   u   aca     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002644.1: 179818-179909 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-92a-2
oha-mir-18bAZIM01002644.1: 177020-177099 [+]
oha-mir-20bAZIM01002644.1: 179551-179635 [+]
oha-mir-92a-2AZIM01002644.1: 179818-179909 [+]
oha-mir-363AZIM01002644.1: 179985-180068 [+]
Database links

Mature sequence oha-miR-92a

Accession MIMAT0036960
Sequence

52 - 

uauugcacuugucccggccugu

 - 73

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).