Stem-loop sequence ssc-mir-9804

AccessionMI0031568 (change log)
DescriptionSus scrofa miR-9804 stem-loop
Stem-loop
   -----------a       c   ca    -   agga     a ac 
5'             gaggguu acc  ggau cag    uggac c  a
               ||||||| |||  |||| |||    ||||| |  g
3'             uucuuaa ugg  ccua guc    acuug g  g
   ggacucgagucc       -   ac    a   --gg     - aa 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 54210990-54211068 [-]
intergenic
Database links

Mature sequence ssc-miR-9804-5p

Accession MIMAT0037022
Sequence

11 - 

cccaggaucagaggauggaca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).