Stem-loop sequence ssc-mir-9805

AccessionMI0031569 (change log)
DescriptionSus scrofa miR-9805 stem-loop
Stem-loop
   uc  g      ---    a     -  --   agcaggaaccuggagcu 
5'   ca ugaagg   cguc gauag cc  ggg                 c
     || ||||||   |||| ||||| ||  |||                 g
3'   gu gcuucc   guag cuguc gg  ccc                 g
   gu  -      ucu    g     u  ga   gcagagacucgagcuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 213676752-213676845 [-]
sense
ENSSSCT00000013204 ; DSCAM-201; intron 33
Database links

Mature sequence ssc-miR-9805-3p

Accession MIMAT0037023
Sequence

64 - 

cccagggucugucggaugucu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).