Stem-loop sequence ssc-mir-9808

AccessionMI0031575 (change log)
DescriptionSus scrofa miR-9808 stem-loop
Stem-loop
   ug       u   c   cu u   uu    -ccu     ca 
5'   caggugu agu uuc  c ccu  ugua    gucaa  a
     ||||||| ||| |||  | |||  ||||    |||||   
3'   guccaca uca agg  g ggg  acgu    caguu  g
   ua       u   u   cu u   --    uccu     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 34705705-34705785 [-]
intergenic
Database links

Mature sequence ssc-miR-9808-3p

Accession MIMAT0037026
Sequence

51 - 

ccuugcagggugucggauacu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).