Stem-loop sequence ssc-mir-9824

AccessionMI0031591 (change log)
DescriptionSus scrofa miR-9824 stem-loop
Stem-loop
   guga     u    -ga    -a       -g   g gg 
5'     gccuc ggcg   ggcg  ucggggu  gcc u  g
       ||||| ||||   ||||  |||||||  ||| |   
3'     uggag ucgc   ucgu  gguccca  cgg a  g
   gaag     -    gac    gg       ga   g ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 2816327-2816402 [-]
intergenic
Database links

Mature sequence ssc-miR-9824-5p

Accession MIMAT0037042
Sequence

11 - 

ggcggaggcgaucgggguggc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).