Stem-loop sequence ata-MIR164c

AccessionMI0031724 (change log)
DescriptionAegilops tauschii miR164c stem-loop
Gene family MIPF0000045; MIR164
Stem-loop
   --       c c     a  c            -    -   -    ---gu    -       u  u  c 
5'   aggaccg g uggag ag agggcacgugca ugca ugc gggc     gcuc gaucuca cc gc u
     ||||||| | ||||| || |||||||||||| |||| ||| ||||     |||| ||||||| || ||  
3'   uucuggc c accuc uc ucuugugcacgu acgu acg cccg     cgag cuagggu gg ug c
   cu       a u     c  u            c    c   u    aucgu    g       -  c  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 58088902-58089035 [+]
intergenic
Database links

Mature sequence ata-miR164c-5p

Accession MIMAT0037242
Sequence

11 - 

uggagaagcagggcacgugca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR164c-3p

Accession MIMAT0037243
Sequence

104 - 

cacguguucuucuccuccauc

 - 124

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).