Stem-loop sequence cre-MIR9897

AccessionMI0031825 (change log)
DescriptionChlamydomonas reinhardtii miR9897 stem-loop
Stem-loop
   --   a ga  ug   g gga                                                                gg 
5'   aga g  cg  gac u   ugccgauaagaaggagccguaagguaccgggcguggggagggcaggggcagggacggggaucag  g
     ||| |  ||  ||| |   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
3'   ucu c  gc  uug g   acggcuauucuuccucggcauuccauggcccgcgccccucccguccccgucccugccccuaguc  c
   gg   - gg  cu   g -ac                                                                ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR1174 in [1].

Database links

Mature sequence cre-miR9897-5p

Accession MIMAT0037303
Sequence

44 - 

uaccgggcguggggagggcagg

 - 65

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cre-miR9897-3p

Accession MIMAT0037304
Sequence

132 - 

uuacggcuccuucuuaucggc

 - 152

Get sequence
Evidence experimental; Illumina [1]

References

1