Software error:

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Attempting to set the sequence to [ ACCGGCGGUUGGAAGGGUGCCGGGCCAGACUGUACUGCGUCACAGUCUUCUUCUUCCAUGACUGGAACGCGUAUUGUUCGAGAACGCCUGAAAUAUAUUUAUUCAAG] which does not look healthy
STACK: Error::throw
STACK: Bio::Root::Root::throw ../lib/bioperl-1.6/Bio/Root/Root.pm:357
STACK: Bio::PrimarySeq::seq ../lib/bioperl-1.6/Bio/PrimarySeq.pm:271
STACK: Bio::PrimarySeq::new ../lib/bioperl-1.6/Bio/PrimarySeq.pm:221
STACK: Bio::Seq::new ../lib/bioperl-1.6/Bio/Seq.pm:484
STACK: Bio::Mir::DB::RDB_SELECT::get_seq_by_species ../lib/mirbase/Bio/Mir/DB/RDB_SELECT.pm:686
STACK: /srv/web/www/cgi-bin/mirna_summary.pl:81
-----------------------------------------------------------

For help, please send mail to the webmaster (root@localhost), giving this error message and the time and date of the error.