Read MR0000011182

Accession MR0000011182
Sequence 
uuccacagcuuucuugaacuu
Organism Arabidopsis thaliana
Stem-loop ID ath-MIR396a ath-MIR396b
Mature ID ath-miR396a ath-miR396b

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000003 809 whole body GEO : GSM253622 [ Mi S et al.]
ER0000000004 23 whole body GEO : GSM253623 [ Mi S et al.]
ER0000000005 78 whole body GEO : GSM253624 [ Mi S et al.]
ER0000000006 37 whole body GEO : GSM253625 [ Mi S et al.]
ER0000000208 18 flower GEO : GSM118372 [ Rajagopalan R et al.]
ER0000000209 23 rosette leaf GEO : GSM118373 [ Rajagopalan R et al.]
ER0000000210 46 seedling GEO : GSM118374 [ Rajagopalan R et al.]
ER0000000211 90 silique GEO : GSM118375 [ Rajagopalan R et al.]

References

1
PMID : 18342361
  • "Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide"
    • Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, Chen S, Hannon GJ, Qi Y. Cell. 133:116-127(2008).
    2
    PMID : 17182867
  • "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
    • Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).