Read MR0000038346

AccessionMR0000038346
Sequence
aaucacaggauuauacugugag
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-308

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueLinkCommentReference
ER0000000010107HeadGEO : GSM240749 [ Chung WJ et al.]
ER0000000011328S2 cellGEO : GSM272651 [ Chung WJ et al.]
ER0000000012531S2 cellGEO : GSM272652 [ Chung WJ et al.]
ER0000000013511Kc cellGEO : GSM272653 [ Chung WJ et al.]
ER000000001449Imaginal discGEO : GSM275691 [ Chung WJ et al.]
ER0000000015108HeadGEO : GSM286601 [ Chung WJ et al.]
ER000000001635Whole bodyGEO : GSM286602 [ Chung WJ et al.]
ER000000001780Whole bodyGEO : GSM286603 [ Chung WJ et al.]
ER00000000181346EmbryoGEO : GSM286604 [ Chung WJ et al.]
ER00000000192704EmbryoGEO : GSM286605 [ Chung WJ et al.]
ER0000000020250EmbryoGEO : GSM286606 [ Chung WJ et al.]
ER0000000021712EmbryoGEO : GSM286607 [ Chung WJ et al.]
ER0000000022970EmbryoGEO : GSM286611 [ Chung WJ et al.]
ER0000000023761EmbryoGEO : GSM286613 [ Chung WJ et al.]
ER000000007973Whole bodyGEO : GSM3222083rd instar larvae
ER0000000080171Whole bodyGEO : GSM3222192-4 day old pupae
ER000000008118Whole bodyGEO : GSM3222453rd instar larvae
ER000000008225Whole bodyGEO : GSM3223382-4 day old pupae
ER0000000083225HeadGEO : GSM322533Age: Adult; Gender: Female
ER00000000841857HeadGEO : GSM322543Age: Adult; Gender: Male
ER000000008537Whole bodyGEO : GSM3602561st instar larvae
ER000000008670Whole bodyGEO : GSM3602571st instar larvae
ER0000000087170Whole bodyGEO : GSM3602600-1 day old pupae
ER00000000881239Whole bodyGEO : GSM3602620-2 day old pupae
ER000000008926EmbryoGEO : GSM364902Age: 12-24 hours
ER000000009014Whole bodyGEO : GSM280082Age: 2-4 days
ER000000009122Whole bodyGEO : GSM280083Age: 2-4 days
ER00000000931Whole bodyGEO : GSM280085Age: 2-4 days
ER00000000942Whole bodyGEO : GSM280086Age: 2-4 days
ER000000009622S2 cellGEO : GSM280088
ER0000000099179Imaginal discGEO : GSM399105Imaginal disc/brain
ER0000000100261Whole bodyGEO : GSM399106Gender: Female
ER0000000101205Whole bodyGEO : GSM399107Gender: Male
ER00000001026S2 cellGEO : GSM371638
ER000000011554HeadGEO : GSM180328Age: Adult; Gender: Female & male[ Ruby JG et al.]
ER000000011615Whole bodyGEO : GSM180329Age: Adult; Gender: Female & male[ Ruby JG et al.]
ER000000011762EmbryoGEO : GSM180330Very early embryo (0-1)[ Ruby JG et al.]
ER000000011891EmbryoGEO : GSM180331Early embryo (2-6)[ Ruby JG et al.]
ER000000011940EmbryoGEO : GSM180332Mid embryo (6-10)[ Ruby JG et al.]
ER000000012013EmbryoGEO : GSM180333Late embryo (12-24)[ Ruby JG et al.]
ER00000001215Whole bodyGEO : GSM180334Larvae: 1st instar and 3rd instar[ Ruby JG et al.]
ER000000012219Imaginal discGEO : GSM180335 [ Ruby JG et al.]
ER000000012310Whole bodyGEO : GSM180336Pupae: 0-1 day, 0-2 day, 2-4 day[ Ruby JG et al.]
ER000000012485S2 cellGEO : GSM180337Tissue culture cells (S2 only)[ Ruby JG et al.]
ER000000012792067OvaryGEO : GSM385744Ovary Somatic Sheet (OSS) cells
ER0000000128194081OvaryGEO : GSM385748Ovary Somatic Sheet (OSS) cells
ER0000000129262609OvaryGEO : GSM385821Ovary Somatic Sheet (OSS) cells
ER0000000130106895OvaryGEO : GSM385822Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).