Read MR0000038346

Accession MR0000038346
Sequence
aaucacaggauuauacugugag
Organism Drosophila melanogaster
Stem-loop ID dme-mir-308

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000010 107 Head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 328 S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 531 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 511 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000014 49 Imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000015 108 Head GEO : GSM286601 [ Chung WJ et al.]
ER0000000016 35 Whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000017 80 Whole body GEO : GSM286603 [ Chung WJ et al.]
ER0000000018 1346 Embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000019 2704 Embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000020 250 Embryo GEO : GSM286606 [ Chung WJ et al.]
ER0000000021 712 Embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000022 970 Embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 761 Embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000079 73 Whole body GEO : GSM322208 3rd instar larvae
ER0000000080 171 Whole body GEO : GSM322219 2-4 day old pupae
ER0000000081 18 Whole body GEO : GSM322245 3rd instar larvae
ER0000000082 25 Whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 225 Head GEO : GSM322533 Age: Adult; Gender: Female
ER0000000084 1857 Head GEO : GSM322543 Age: Adult; Gender: Male
ER0000000085 37 Whole body GEO : GSM360256 1st instar larvae
ER0000000086 70 Whole body GEO : GSM360257 1st instar larvae
ER0000000087 170 Whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 1239 Whole body GEO : GSM360262 0-2 day old pupae
ER0000000089 26 Embryo GEO : GSM364902 Age: 12-24 hours
ER0000000090 14 Whole body GEO : GSM280082 Age: 2-4 days
ER0000000091 22 Whole body GEO : GSM280083 Age: 2-4 days
ER0000000093 1 Whole body GEO : GSM280085 Age: 2-4 days
ER0000000094 2 Whole body GEO : GSM280086 Age: 2-4 days
ER0000000096 22 S2 cell GEO : GSM280088
ER0000000099 179 Imaginal disc GEO : GSM399105 Imaginal disc/brain
ER0000000100 261 Whole body GEO : GSM399106 Gender: Female
ER0000000101 205 Whole body GEO : GSM399107 Gender: Male
ER0000000102 6 S2 cell GEO : GSM371638
ER0000000115 54 Head GEO : GSM180328 Age: Adult; Gender: Female & male [ Ruby JG et al.]
ER0000000116 15 Whole body GEO : GSM180329 Age: Adult; Gender: Female & male [ Ruby JG et al.]
ER0000000117 62 Embryo GEO : GSM180330 Very early embryo (0-1) [ Ruby JG et al.]
ER0000000118 91 Embryo GEO : GSM180331 Early embryo (2-6) [ Ruby JG et al.]
ER0000000119 40 Embryo GEO : GSM180332 Mid embryo (6-10) [ Ruby JG et al.]
ER0000000120 13 Embryo GEO : GSM180333 Late embryo (12-24) [ Ruby JG et al.]
ER0000000121 5 Whole body GEO : GSM180334 Larvae: 1st instar and 3rd instar [ Ruby JG et al.]
ER0000000122 19 Imaginal disc GEO : GSM180335 [ Ruby JG et al.]
ER0000000123 10 Whole body GEO : GSM180336 Pupae: 0-1 day, 0-2 day, 2-4 day [ Ruby JG et al.]
ER0000000124 85 S2 cell GEO : GSM180337 Tissue culture cells (S2 only) [ Ruby JG et al.]
ER0000000127 92067 Ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 194081 Ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 262609 Ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells
ER0000000130 106895 Ovary GEO : GSM385822 Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).