Read MR0000038346

Accession MR0000038346
Sequence
aaucacaggauuauacugugag
Organism Drosophila melanogaster
Stem-loop ID dme-mir-308

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000010 107 head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 328 S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 531 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 511 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000014 49 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000015 108 head GEO : GSM286601 [ Chung WJ et al.]
ER0000000016 35 whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000017 80 whole body GEO : GSM286603 [ Chung WJ et al.]
ER0000000018 1346 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000019 2704 embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000020 250 embryo GEO : GSM286606 [ Chung WJ et al.]
ER0000000021 712 embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000022 970 embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 761 embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000079 73 whole body GEO : GSM322208 3rd instar larvae
ER0000000080 171 whole body GEO : GSM322219 2-4 day old pupae
ER0000000081 18 whole body GEO : GSM322245 3rd instar larvae
ER0000000082 25 whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 225 head GEO : GSM322533 adult female head
ER0000000084 1857 head GEO : GSM322543 adult male head
ER0000000085 37 whole body GEO : GSM360256 1st instar larvae
ER0000000086 70 whole body GEO : GSM360257 1st instar larvae
ER0000000087 170 whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 1239 whole body GEO : GSM360262 0-2 day old pupae
ER0000000089 26 embryo GEO : GSM364902 12-24hr embryo
ER0000000090 14 whole body GEO : GSM280082 from 2-4 day old flies
ER0000000091 22 whole body GEO : GSM280083 from 2-4 day old flies
ER0000000093 1 whole body GEO : GSM280085 from 2-4 day old flies
ER0000000094 2 whole body GEO : GSM280086 from 2-4 day old flies
ER0000000096 22 S2 cell GEO : GSM280088
ER0000000099 179 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000100 261 whole body GEO : GSM399106 female body
ER0000000101 205 whole body GEO : GSM399107 male body
ER0000000102 6 S2 cell GEO : GSM371638
ER0000000115 54 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000116 15 whole body GEO : GSM180329 adult bodies (female bodies, male bodies) [ Ruby JG et al.]
ER0000000117 62 embryo GEO : GSM180330 very early embryo (0-1) [ Ruby JG et al.]
ER0000000118 91 embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]
ER0000000119 40 embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]
ER0000000120 13 embryo GEO : GSM180333 late embryo (12-24) [ Ruby JG et al.]
ER0000000121 5 whole body GEO : GSM180334 larvae: 1st instar and 3rd instars [ Ruby JG et al.]
ER0000000122 19 imaginal disc GEO : GSM180335 [ Ruby JG et al.]
ER0000000123 10 whole body GEO : GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day [ Ruby JG et al.]
ER0000000124 85 S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]
ER0000000127 92067 ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 194081 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 262609 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells
ER0000000130 106895 ovary GEO : GSM385822 Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).