Read MR0000042142

Accession MR0000042142
Sequence 
acccguaaauccgaacuugu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-100
Mature ID dme-miR-100-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000010 3 head GEO : GSM240749 [ Chung WJ et al.]
ER0000000015 2 head GEO : GSM286601 [ Chung WJ et al.]
ER0000000081 1 whole body GEO : GSM322245 3rd instar larvae
ER0000000083 1 head GEO : GSM322533 adult female head
ER0000000090 1 whole body GEO : GSM280082 from 2-4 day old flies
ER0000000101 1 whole body GEO : GSM399107 male body

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).