Read MR0000066894

Accession MR0000066894
Sequence 
cgugguuggugguugaacuucgauu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-973
Mature ID dme-miR-973-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000014 1 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000021 3 embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000099 3 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000119 1 embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).