Read MR0000129054

Accession MR0000129054
Sequence
aaugacacgaucacucccguugagug
Organism Mus musculus
Stem-loop ID mmu-mir-425
Mature ID mmu-miR-425-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000032 1 testes GEO : GSM510436 [ Chiang HR et al.]
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 2 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000055 1 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000061 1 embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 1 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 4 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 1 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 2 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000234 1 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 1 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000240 1 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000250 2 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000258 1 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000260 1 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 1 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
  • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).