Read MR0000180555

Accession MR0000180555
Sequence 
gagguaggagguuguauaguug
Organism Mus musculus
Stem-loop ID mmu-let-7a-1 mmu-let-7a-2 mmu-let-7e
Mature ID mmu-let-7a-5p mmu-let-7a-5p mmu-let-7e-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000037 2 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 2 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 10 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000054 1 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 1 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000059 1 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000063 2 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 2 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 1 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000233 1 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 3 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000242 6 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 14 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 2 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 1 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000248 12 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 21 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 10 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 6 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 10 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 4 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 3 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 2 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 2 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 1 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 3 ovary GEO : GSM539878 strain: C57BL/6J, gender: female

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).