Read MR0000217893

Accession MR0000217893
Sequence 
cugagguaggagguuguauaguuga
Organism Mus musculus
Stem-loop ID mmu-let-7e
Mature ID mmu-let-7e-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 2 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).