Read MR0000248587

Accession MR0000248587
Sequence 
gucccugagacccuaacuugug
Organism Mus musculus
Stem-loop ID mmu-mir-125b-2 mmu-mir-125b-1
Mature ID mmu-miR-125b-5p mmu-miR-125b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 1 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000045 1 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 3 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 3 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 4 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 2 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 18 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000059 1 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).