Read MR0000334109

Accession MR0000334109
Sequence 
ucgggaaugucguguccgccca
Organism Mus musculus
Stem-loop ID mmu-mir-425
Mature ID mmu-miR-425-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000052 4 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 10 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 3 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000229 1 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000235 3 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 2 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 3 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 2 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).