Read MR0000706485

Accession MR0000706485
Sequence 
cucggcguggcgucggucguggu
Organism Homo sapiens
Stem-loop ID hsa-mir-1307
Mature ID hsa-miR-1307-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000103 10 melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 6 melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 5 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 2 melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000108 31 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 6 melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 48 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 16 melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 7 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 3 melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 35 melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000264 1 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 1 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
    2
    PMID : 19144710
  • "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
    • Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).