Read MR0000777778

Accession MR0000777778
Sequence 
acucacggcauuucauucacuug
Organism Drosophila melanogaster
Stem-loop ID dme-mir-2535b
Mature ID dme-miR-2535b-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000012 1 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000015 1 head GEO : GSM286601 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000083 2 head GEO : GSM322533 adult female head
ER0000000084 31 head GEO : GSM322543 adult male head
ER0000000088 1 whole body GEO : GSM360262 0-2 day old pupae
ER0000000102 1 S2 cell GEO : GSM371638

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).