Read MR0000852050

AccessionMR0000852050
Sequence
uggaauguaaagacguauguau
OrganismMus musculus
Stem-loop ID mmu-mir-1a-1mmu-mir-1a-2

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueSRA accessionCommentReference
ER00000000343testesSRR037902 1638
ER00000000371brainSRR037905 1638
ER00000000391brainSRR037907 1638
ER00000000413whole bodySRR037908newborn1638
ER00000000424whole bodySRR037909newborn1638
ER000000004310whole bodySRR037910newborn1638
ER000000004422whole bodySRR037911newborn1638
ER000000004570whole bodySRR037912newborn1638
ER000000004745whole bodySRR037914newborn1638
ER00000000543embryoSRR037920day 12.5 embryo1638
ER00000000557embryoSRR037921day 12.5 embryo1638
ER00000000566embryoSRR037922day 12.5 embryo1638
ER00000000581embryoSRR037924day 9.5 embryo1638
ER00000000621embryoSRR037928day 7.5 embryo1638
ER00000000631embryoSRR037929day 7.5 embryo1638
ER000000021696bone marrowSRR042443strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER00000002351bone marrowSRR042462strain: C57BL/6J, gender: male
ER00000002481undefinedSRR042475strain: C57BL/6J, developmental stage: E13.5
ER0000000249344heartSRR042476strain: C57BL/6J, gender: male
ER00000002501brainSRR042477strain: C57BL/6J, gender: male
ER00000002514lungSRR042478strain: C57BL/6J, gender: male
ER00000002541pancreasSRR042481strain: C57BL/6J, gender: male
ER000000025513skinSRR042482strain: C57BL/6J, gender: male
ER000000025668skeletal muscleSRR042483strain: C57BL/6J, gender: male
ER00000002571salivary glandsSRR042484strain: C57BL/6J, gender: male
ER00000002581testesSRR042485strain: C57BL/6J, gender: male
ER000000025910ovarySRR042486strain: C57BL/6J, gender: female