Read MR0000852050

AccessionMR0000852050
Sequence
cucggaccaggcuucauucccu
OrganismOryza sativa
Stem-loop ID osa-MIR166aosa-MIR166bosa-MIR166cosa-MIR166dosa-MIR166eosa-MIR166fosa-MIR166kosa-MIR166losa-MIR166gosa-MIR166mosa-MIR166j

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueLinkCommentReference
ER000000020122Whole bodyGEO : GSM571077Strain: Indica 93-11; Age: 12-day-old; Stress: Control[ Li T et al.]
ER00000004211SeedlingGEO : GSM816690Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare[ Jeong DH et al.]
ER00000004381RootGEO : GSM816707Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare[ Jeong DH et al.]
ER00000004421RootGEO : GSM816711Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare[ Jeong DH et al.]
ER00000004441RootGEO : GSM816713Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare[ Jeong DH et al.]
ER00000004501ShootGEO : GSM816719Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare[ Jeong DH et al.]
ER00000004701PanicleGEO : GSM816739Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare[ Jeong DH et al.]

References

1
2
PMID : 22158467
  • "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"
  • Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).