Read MR0000852050

Accession MR0000852050
Sequence
cucggaccaggcuucauucccu
Organism Oryza sativa
Stem-loop ID osa-MIR166a osa-MIR166b osa-MIR166c osa-MIR166d osa-MIR166e osa-MIR166f osa-MIR166k osa-MIR166l osa-MIR166g osa-MIR166m osa-MIR166j

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000201 22 Whole body GEO : GSM571077 Strain: Indica 93-11; Age: 12-day-old; Stress: Control [ Li T et al.]
ER0000000421 1 Seedling GEO : GSM816690 Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare [ Jeong DH et al.]
ER0000000438 1 Root GEO : GSM816707 Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare [ Jeong DH et al.]
ER0000000442 1 Root GEO : GSM816711 Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare [ Jeong DH et al.]
ER0000000444 1 Root GEO : GSM816713 Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare [ Jeong DH et al.]
ER0000000450 1 Shoot GEO : GSM816719 Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare [ Jeong DH et al.]
ER0000000470 1 Panicle GEO : GSM816739 Cultivar: Oryza sativa L, ssp. japonica cv. Nipponbare [ Jeong DH et al.]

References

1
2
PMID : 22158467
  • "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"
  • Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).