Read MR0000852050

Accession MR0000852050
Sequence
cucggaccaggcuucauucccu
Organism Oryza sativa
Stem-loop ID osa-MIR166a osa-MIR166b osa-MIR166c osa-MIR166d osa-MIR166e osa-MIR166f osa-MIR166k osa-MIR166l osa-MIR166g osa-MIR166m osa-MIR166j

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000201 22 whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]

References

1