Read MR0000904552

Accession MR0000904552
Sequence 
agaucguucaguacggcaau
Organism Caenorhabditis elegans
Stem-loop ID cel-mir-58
Mature ID cel-miR-58-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000203 4 adult GEO : GSM604032 strain: N2 wild-type, age: Day 0 [ de Lencastre A et al.]
ER0000000204 7 adult GEO : GSM604033 strain: N2 wild-type, age: Day 10 [ de Lencastre A et al.]
ER0000000205 3 adult GEO : GSM604034 strain: daf-2(e1379) mutant, age: Day 0 [ de Lencastre A et al.]
ER0000000206 12 adult GEO : GSM604035 strain: daf-2(e1379) mutant, age: Day 10 [ de Lencastre A et al.]

References

1
PMID : 21129974
  • "MicroRNAs both promote and antagonize longevity in C. elegans"
    • de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).