Read MR0000906029

Accession MR0000906029
Sequence
ccuguagaucgagcugugugu
Organism Caenorhabditis elegans
Stem-loop ID cel-mir-57
Mature ID cel-miR-57-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000204 2 adult GEO : GSM604033 strain: N2 wild-type, age: Day 10 [ de Lencastre A et al.]
ER0000000205 2 adult GEO : GSM604034 strain: daf-2(e1379) mutant, age: Day 0 [ de Lencastre A et al.]
ER0000000212 2 whole body GEO : GSM139137 mixed-stage [ Ruby JG et al.]

References

1
PMID : 21129974
  • "MicroRNAs both promote and antagonize longevity in C. elegans"
  • de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).
    2
    PMID : 17174894
  • "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
  • Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).