Read MR0001128979

Accession MR0001128979
Sequence
ucgggaaugucguguccgcccagu
Organism Mus musculus
Stem-loop ID mmu-mir-425
Mature ID mmu-miR-425-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting