sort by

9 publications mentioning cel-mir-2

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 15
These genes are not yet known to be miRNA targets, and therefore constitute strong candidates for experimental verification of regulation by members of the miR-2 family. [score:4]
In another case, also in worms, the target sites for two coconserved and distinct miRNAs (or miRNA sets) miR-2/miR-43 (CUGUGAU) and miR-80/miR-81/miR-82 (UGAUCUC), were found to overlap more often than expected by chance (p < 10 [−5]) (note that we limited the extent of the overlap to 4 nt in our coconservation analysis). [score:3]
For example, Figure 5B shows that some worm miRNAs potentially regulate hundreds of genes (e. g., miR-2/ miR-43), while others may regulate fewer than ten genes (e. g., miR-273). [score:3]
Similarly, the target sites for miR-2/43 and miR-1 are coconserved in 12 genes (p < 10 [−6]). [score:3]
As another example, recent in vitro and in vivo experiments suggest that members of the fly miR-2 family (miR-2a/2b/2c) regulate the proapoptotic genes reaper, grim, and sickle in D. melanogaster [9]. [score:2]
[1 to 20 of 5 sentences]
2
[+] score: 14
The miR expression profile of E. granulosus was studied for its different developmental stages and the protoscolex and cyst wall both showed the expression of miR-2, miR-9, miR-10, miR-27, let-7, and miR-71 except for miR-125 which was present only on protoscolex (Cucher et al., 2011). [score:6]
These miRs are involved in metamorphosis of parasite along with let-2. The protoscolex of E. granulosus had higher expression of miR-2 and miR-125 and their sequence showed variability, suggesting that it is due to binding to various 3′UTR targets. [score:5]
The miR-125 and miR-2 in the storbilated stage suggests their role in correct sexual development via notch signaling (miR-125). [score:2]
To identify the miRNAs present in adult C. sinensis, deep sequencing and bioinformatics extrapolations combined with stem-loop real-time PCR analysis approach was applied (Xu et al., 2010), they identified a total of 62,512 conserved miRNAs which belonged to 284 families along with six novel miRNA (cis-miR-001, cis-miR-2, cis-miR-6, cis-miR-10, cis-miR-18, and cis-miR-19). [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 11
Notably, we found mir-2-5p, mir-46-3p and mir-47-3p to be stably expressed in all conditions (Figures 2 and 3 and Additional file 4: Figure S1, Additional file 5: Figure S2, Additional file 6: Figure S3). [score:3]
All conditions: mir-47-3p (21043,167 reads), mir-46-3p (22186,815 reads) and mir-2-5p (5977,944 reads) were stably expressed in all the conditions and therefore chosen to validate by qPCR (Figure 4). [score:3]
Click here for file miRNAs included in Venn’s diagram of Figure 1. Click here for file Graphical output files from mirDeep2 showing the reads, counts per read and mapping on the hairpin for mir-2, mir-46 and mir-47. [score:1]
Graphical output files from mirDeep2 showing the reads, counts per read and mapping on the hairpin for mir-2, mir-46 and mir-47. [score:1]
Click here for file Graphical output files from mirDeep2 showing the reads, counts per read and mapping on the hairpin for mir-2, mir-46 and mir-47. [score:1]
I. mir-46-3p, mir-47-3p and mir-2-5p are stable in all conditions tested, II. [score:1]
Interestingly, we also found that 3 miRNAs, namely mir-2-5p, mir-46-3p and mir-47-3p, are stable in all the above-mentioned conditions suggesting that they might have general functions independent of stress. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 10
Other miRNAs from this paper: cel-mir-71, cel-mir-124
In contrast to miR-2, the anatomical expression of miR-71 appears to be ubiquitous, suggesting that tissue-centric target analysis provides complementary information that is not captured by expression studies. [score:7]
miR-2 showed a pattern of neuronal depletion similar to mir-124's pattern, implying that it is also involved in neuronal differentiation; this is consistent with the exclusively neuronal pattern of GFP expressed from the miR-2 promoter [56]. [score:3]
[1 to 20 of 2 sentences]
5
[+] score: 7
Interestingly, mir-71 is expressed at all stages and in all cells excluding germline (Table 1), whereas mir-2, which resides in a different intron of the same host gene ppfr-1, is prominently expressed in neurons [36]. [score:5]
In addition, two other intronic miRNAs (mir-2 and mir-82) were recently shown to have their own promoters [36]. [score:1]
Indeed, a promoter activity has been previously demonstrated for three of these regions (Table 1) - lin-4 [36- 38], mir-2 and mir-82 [36]. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 5
Functional roles have been described for Drosophila mir-2 in suppressing embryonic apoptosis [59] and for C. elegans mir-71 in lifespan and stress responses [60]. [score:3]
Although the genomic organisation of C. elegans mir-2 and mir-71 (separated by ~7 kb) does not constitute a cluster by the criteria applied here, their relative proximity in C. elegans and tight clustering in H. contortus may suggest functional linkage of these two miRNAs. [score:1]
Interestingly, mir-71 and mir-2 are found as a clustered pair in H. contortus. [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 3
Relative miRNA levels were normalized to miR-2-5p, which was previously determined to have stable expression under various stress -induced conditions including heat shock [25]. [score:3]
[1 to 20 of 1 sentences]
8
[+] score: 2
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-58a, cel-mir-238, cel-mir-58b, cel-mir-58c
Sequences for oligo probes used for the detection of endogenous small RNAs were: miR-238, CTGAATGGCATCGGAGTACAAA; miR-58, ATTGCCGTACTGAACGATCTCA; miR-2, GCACATCAAAGCTGGCTGTGATA; lin-4, TCACACTTGAGGTCTCAGGGA; Let-7, AACTATACAACCTACTACCTCA; X-cluster siRNA, CGCGTATCTATTCAATTGAAT; K02E2.6 siRNA, ATCAGTTACTTGCCAATTTC; and 21U-1, CACGGTTAACGTACGTACCA Transgenic lines in either drh-1(tm1329) or drh-2(ok951) background that carried an extrachromosomal array corresponding to WRW0640F2 were produced with microinjection, and were crossed respectively with drh-1(tm1329) and drh-2(ok951) animals homozygous for FR1gfp transgene. [score:1]
Sequences for oligo probes used for the detection of endogenous small RNAs were: miR-238, CTGAATGGCATCGGAGTACAAA; miR-58, ATTGCCGTACTGAACGATCTCA; miR-2, GCACATCAAAGCTGGCTGTGATA; lin-4, TCACACTTGAGGTCTCAGGGA; Let-7, AACTATACAACCTACTACCTCA; X-cluster siRNA, CGCGTATCTATTCAATTGAAT; K02E2.6 siRNA, ATCAGTTACTTGCCAATTTC; and 21U-1, CACGGTTAACGTACGTACCA drh-1 and drh-2 functional rescue experimentsTransgenic lines in either drh-1(tm1329) or drh-2(ok951) background that carried an extrachromosomal array corresponding to WRW0640F2 were produced with microinjection, and were crossed respectively with drh-1(tm1329) and drh-2(ok951) animals homozygous for FR1gfp transgene. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 1
Loss of certain miRNAs or miRNA families led to hypoxia sensitivity (mir-2, mir-35, mir-44, mir-49, mir-51, mir-60, mir-63 and mir-67) and others to hypoxia resistance (let-7, mir-58, mir-67, mir-79, mir-237, mir-246, mir-359). [score:1]
[1 to 20 of 1 sentences]