sort by

252 publications mentioning hsa-mir-25 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-25. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 233
Other miRNAs from this paper: hsa-mir-93, hsa-mir-106b
miR-25 expression dramatically downregulated PKCζ mRNA (Figure 1C) and protein (Figure 1D) expression in OB-6 cells. [score:8]
To test whether PKCζ downregulation was the reason of AMPK activation in miR-25 -expressing osteoblastic cells, shRNA strategy was applied to knockdown PKCζ in OB-6 cells. [score:7]
miR-25-5p upregulation correlates with PKCζ downregulation and AMPK activation in human osteonecrosis tissues. [score:7]
Similar results were also obtained in hFOB1.19 osteoblastic cells, where miR-25 expression (Figure 1E) downregulated PKCζ (Figure 1F), and activated AMPK signaling (Figure 1G). [score:6]
Figure 6Expressions of miR-25-5p A. and PKCζ mRNA B. in surgery-isolated femoral head tissues (both normal or “S” and necrotic or “N”) from GC-taking patients (n=9) were tested by qRT-PCR assay; Expression of listed protein was tested by Western blots (C, and PKCζ expression was quantified in D). [score:6]
Fortunately, here we show that miR-25-5p targets and downregulates PKCζ in osteoblastic cells, which activates AMPK signaling and protects cells against Dex. [score:6]
Intriguingly, in human necrotic femoral head tissues, miR-25-5p expression was significantly increased, which was correlated with PKCζ downregulation and AMPK activation. [score:6]
To test if miR-25 could downregulate PKCζ in osteoblasts, a pre-miR-25 -expressing construct was transfected it to OB-6 osteoblastic cells. [score:6]
Expressions of miR-25-5p A. and PKCζ mRNA B. in surgery-isolated femoral head tissues (both normal or “S” and necrotic or “N”) from GC-taking patients (n=9) were tested by qRT-PCR assay; Expression of listed protein was tested by Western blots (C, and PKCζ expression was quantified in D). [score:6]
Therefore, antagomiR-25 downregulates miR-25-5p and inhibits AMPK activation, which then potentiates Dex damages in human osteoblastic cells. [score:6]
qRT-PCR results confirmed miR-25-5p over -expression (Figure 4E) and PKCζ downregulation (Figure 4F) in these cells. [score:6]
The expression of microRNA-25-3p (“miR-25-3p”) was also tested in these cells, and its level was not significantly increased following expression of pre-miR-25 (Supplementary Figure S1). [score:5]
PKCζ shRNA (“-1”) -expressing OB-6 cells were transfected with miR-25, expressions of miR-25-5p E. and PKCζ mRNA F. were shown; These cells were also treated with or without Dex (1 μM) for 24 hours, cell viability G. and apoptosis H. were tested. [score:5]
Through searching the miRNA database (TargetScan v7.1), microRNA-25-5p (“miR-25-5p”) is found to selectively targets PKCζ. [score:5]
Figure 1 A. microRNA-25-5p (“miR-25-5p”) targets the 3’ untranslated regions of human PKCζ. [score:5]
Based on the above results, we propose that miR-25 expression activates AMPK signaling to inhibit oxidative stress, and eventually protects osteoblastic cells from Dex. [score:5]
Expression of miR-25 inhibited Dex -induced osteoblastic cell death and apoptosis. [score:5]
First, microRNA-25-5p (“miR-25-5p”) indeed targets PKCζ's 3’ untranslated regions (UTRs, position 327-334) (Figure 1A). [score:5]
A. microRNA-25-5p (“miR-25-5p”) targets the 3’ untranslated regions of human PKCζ. [score:5]
Expression of antagomiR-25 did reduce miR-25-5p expression in OB-6 cells (Figure 3A, left). [score:5]
Here, the in vitro results showed that miR-25-5p downregulated PKCζ and activated AMPK signaling to protect osteoblastic cell from Dex. [score:4]
Importantly, we show that miR-25 downregulates PKCζ and protects osteoblastic cells from Dex possibly via activating AMPK signaling. [score:4]
Human osteoblastic OB-6 cells B-D. or hFOB1.19 cells E-G. were transfected with has-pre-miR-25 or the control microRNA (“miR-C”), and stable cells were established; Expressions of miR-25-5p (B and E) and PKCζ mRNA (C and F) were tested by quantitative real-time PCR (“qRT-PCR”) assay; Expression of listed proteins in these cells was tested by, and phosphorylations of AMPKα and ACCα were quantified (D and G). [score:4]
In the necrotic tissues, the level of miR-25-5p was upregulated (Figure 6A), yet PKCζ (protein and mRNA) level was decreased (Figure 6B-6D). [score:4]
In many cancers, miR-25 acts as an oncogene, and exerts pro-growth, anti-apoptotic, cell cycle-promoting activity via regulation of its target genes, including Bim, p57 and death receptor 4 (DR4) [27– 29]. [score:4]
Therefore, miR-25 upregulation and PKCζ depletion could be at least one reason of AMPK activation in patients’ necrotic femoral head tissues [23]. [score:4]
microRNA-25 downregulates PKCζ and activates AMPK signaling in human osteoblastic cells. [score:4]
In summary, these results conclude that miR-25 targets PKCζ and protects osteoblastic cells from Dex via activating AMPK signaling. [score:3]
AMPKα shRNA or dominant negative AMPKα (“dn-AMPKα”, T172A) was introduced to the miR-25 -expressing OB-6 cells. [score:3]
Figure 4OB-6 cells were infected with lentiviral PKCζ shRNA (“-1 or -2”) or non-sense control shRNA (“scr shRNA”), and stable cells were established; miR-25-5p and PKCζ mRNA expression levels in these cells were tested A., PKCζ protein expression and AMPK activation were also tested B. Above cells were treated with or without Dex (1 μM) for 24 hours, cell viability (C, MTT assay) and apoptosis (D, Histone DNA ELISA assay) were shown. [score:3]
miR-25 was then expressed in the PKCζ-silenced cells. [score:3]
Intriguingly, expression of miR-25 failed to further protect OB-6 cells from Dex in PKCζ-silenced cells (Figure 4G and 4H). [score:3]
Since AMPK activation would exert a pro-survival function in osteoblasts/osteoblastic cells [7, 22, 23], miR-25 expression should protect osteoblastic cells from Dex. [score:3]
Here, miR-25 expression is pro-survival in human osteoblastic cells. [score:3]
Meanwhile, Dex -induced OB-6 cell apoptosis (Figure 2B) and cell death (Figure 2C) were also significantly inhibited by miR-25. [score:3]
Remarkably, PKCζ shRNA induced significant AMPK activation (p-AMPK/p-ACC) in OB-6 cells (Figure 4B), showing similar phonotype of miR-25 over -expression (Figure 1). [score:3]
Here, miR-25 activated AMPK-NADPH signaling and inhibited Dex -induced ROS production. [score:3]
Although miR-25-5p is a predicted target of PKCζ, it appears to be not conserved. [score:3]
Thus, miR-25 expression activated AMPK and protected osteoblastic cells from Dex. [score:3]
Significantly, miR-25 expression decreased Dex -induced ROS production in OB-6 cells. [score:3]
These results imply that PKCζ might be the primary target of miR-25 in mediating its cytoprotective effect in osteoblastic cells. [score:3]
AMPK shRNA knockdown or dominant negative mutation almost nullified miR-25 -induced NADPH activation (Figure 5E). [score:3]
Pre-miR-25, purchased from Applied Biosystem, was sub-cloned into pSuper-neo (OligoEngine, Seattle, WA) to generate miR-25 expression vector, which was transfected to the osteoblastic cells via Lipofectamine 2000 protocol (Invitrogen, Shanghai, China). [score:3]
As shown in Figure 2A, miR-25 expression indeed attenuated Dex -induced viability reduction in OB-6 cells. [score:3]
OB-6 cells were infected with lentiviral PKCζ shRNA (“-1 or -2”) or non-sense control shRNA (“scr shRNA”), and stable cells were established; miR-25-5p and PKCζ mRNA expression levels in these cells were tested A., PKCζ protein expression and AMPK activation were also tested B. Above cells were treated with or without Dex (1 μM) for 24 hours, cell viability (C, MTT assay) and apoptosis (D, Histone DNA ELISA assay) were shown. [score:3]
miR-25/antagomiR-25 expression. [score:3]
To further confirm the role of miR-25 in osteoblastic cells, antagomiR-25, the miR-25 inhibitor, was introduced into OB-6 osteoblastic cells. [score:3]
Remarkably, such anti-oxidant function by miR-25 was almost blocked with AMPK silence or mutation (Figure 5D). [score:2]
miR-25-5p level was unchanged with PKCζ knockdown (Figure 4A). [score:2]
Mature miR-25 expression in the stable cells was tested by the qRT-PCR assay. [score:2]
Here, miR-25-5p expression level in human necrotic femoral head tissues was tested, and its level was compared with that in the surrounding normal femoral head tissues (Figure 6A). [score:2]
Western blot results in Figure 5A demonstrated that miR-25 -induced AMPK activation was almost blocked by AMPKα shRNA or mutation. [score:2]
It should be noted that AMPKα shRNA or mutation augmented Dex -induced damages in OB-6 cells (no miR-25, Figure 5A-5C). [score:2]
Real-time PCR assay results in Figure 1B confirmed miR-25-5p over -expression in the stable OB-6 cells. [score:2]
On the other hand, AMPK silence or mutation almost abolished miR-25-meidated anti-oxidant and cytoprotection in osteoblastic cells. [score:2]
Expressions of miR-25-5p (A, left), PKCζ mRNA (A, right), and listed proteins B. in stable osteoblastic OB-6 cells with antagomiR-25 or non-sense control microRNA (“miR-C”) were shown; Above cells were treated with or without Dex (1 μM) for 24 hours, cell viability (MTT assay, C. ) and apoptosis (Histone DNA ELISA assay, D. ) were tested. [score:1]
microRNA-25 protects human osteoblastic cells from Dex. [score:1]
Thus, in the following studies, it will be very interesting to further test the possible effect of miR-25-5p in animal mo del of Dex -induced bone damages. [score:1]
Similarly in hFOB1.19 cells, miR-25 alleviated cell viability reduction (Figure 2D), apoptosis induction (Figure 2E) and cell death (Figure 2F) by Dex. [score:1]
miR-25 is a member of miR-106b~25 cluster, which includes miR-106b, miR-93 and miR-25 [26]. [score:1]
It will be interesting to test the potential effect of miR-25-5p on PKCζ and AMPK signaling in other cells. [score:1]
Figure 3Expressions of miR-25-5p (A, left), PKCζ mRNA (A, right), and listed proteins B. in stable osteoblastic OB-6 cells with antagomiR-25 or non-sense control microRNA (“miR-C”) were shown; Above cells were treated with or without Dex (1 μM) for 24 hours, cell viability (MTT assay, C. ) and apoptosis (Histone DNA ELISA assay, D. ) were tested. [score:1]
Significantly, AMPK activation, tested by p-AMPK and p-ACC, was induced by miR-25 in OB-6 cells (Figure 1D). [score:1]
Therefore, miR-25 was no longer cytoprotective when AMPK was silenced or mutated (Figure 5B and 5C). [score:1]
Mature hsa-miR-25-5p expression was assessed using TaqMan microRNA assay using the primer described [34]. [score:1]
Indeed, miR-25 increased NADPH activity in OB-6 cells (Figure 5E). [score:1]
AMPK activation is required for miR-25 -induced cytoprotection in osteoblastic cells. [score:1]
Importantly, miR-25 -induced cytoprotection against Dex was also abolished in AMPKα-silenced or -mutated cells (Figure 5B and 5C). [score:1]
In another words, miR-25 appeared in-effective against Dex when PKCζ was depleted (Figure 4G and 4H). [score:1]
[1 to 20 of 69 sentences]
2
[+] score: 227
Taken together, these finding demonstrate that RBM24 inhibits the expression of MALAT1 through upregulation of the expression of miR-25, which directly targets MALAT1 for degradation. [score:13]
To assess whether and how RBM24 expression inhibits MALAT1 expression, we found that MALAT1 expression was significantly increased (Figure 6a), while miR-25 expression was significantly decreased (Figure 6b), in RBM24 -induced cells following the knock down of RBM24 compared with that in the respective control cells. [score:11]
Moreover, we also observed that the increase or decrease in the expression of lncRNA XIST was consistent for the expression of MALAT1 when suppressing or overexpressing miR-25 expression in the 5-8 F and CNE-2 cells (Supplementary Figure S4). [score:11]
As shown in Figures 6d–f, RBM24 overexpression resulted in a significant increase in the miR-25 expression and reduction in the MALAT1 RNA level compared with control vector transfection in 5-8 F and CNE-2 cells, whereas deletion of the RRM of RBM24 abolished the effects of miR-25 upregulation and MALAT1 inhibition. [score:9]
On the basis of our findings, we propose a mo del in which RBM24 plays a role as a tumor suppressor through the upregulation of miR-25, which directly targets MALAT1 for degradation (Figure 7h). [score:9]
Conversely, suppression of endogenous miR-25 expression resulted in significant attenuation of the proliferative inhibitory effect of RBM24 expression. [score:9]
Tet-Off-inducible RBM24-stable cells were transfected with miR-25 mimics or inhibitor to overexpress or suppress miR-25 expression, respectively. [score:9]
RBM24 inhibits MALAT1 expression by upregulating the miR-25 level. [score:8]
RBM24 exerts its inhibitory effects, at least in part, by upregulating the level of miR-25, which in turn targets MALAT1 for degradation in an Ago2 -dependent manner. [score:8]
Taken together, these results suggest that the suppression of tumorigenicity and invasiveness by RBM24 depends, to a certain extent, on upregulation of the level of miR-25, which in turn targets MALAT1 for degradation. [score:8]
Furthermore, we observed that the knockdown of Ago2 expression, which is the only component of the human RNA -induced silencing complex to have slicer activity, [48] blocked the inhibitory effects of miR-25 on MALAT1-regulated processes. [score:7]
In contrast, the miR-25 inhibitor significantly attenuated the inhibitory effects of RBM24 expression on migration and invasion (Figure 4d). [score:7]
49, 50 This evidence also supports our finding that miR-25 downregulates MALAT1 expression in NPC. [score:6]
The observation that miR-25 expression was upregulated after the induction of RBM24 expression prompted us to further investigate the biological function of miR-25. [score:6]
RBM24 upregulates miR-25 expression in NPC cells. [score:6]
Thus, we conducted experiments to confirm that miR-25 can bind to and inhibit the expression of MALAT1 in NPC cells. [score:5]
Notably, the lncRNA MALAT1, an oncogenic lncRNA that is overexpressed in various human cancers, was the most common lncRNA target of miR-25 in all cancers according to the analysis results. [score:5]
As shown in Figure 7g, the RBM24 mRNA level was positively associated with miR-25 expression (P=0.0002, r=0.8026) and negatively associated with MALAT1 expression (P<0.0001, r=−0.8874). [score:5]
To gain insights into the mechanisms underlying the tumor suppressive function of miR-25, we next identified its target genes in NPC. [score:5]
Taken together, these data indicate that miR-25 can be considered a downstream effector molecule for the inhibitory effects of RBM24 expression in NPC cells. [score:4]
Moreover, the silencing of endogenous RBM24 in NPEC1 Bmi-1 cell line resulted in a significant reduction in the miR-25 expression and increase in the MALAT1 expression compared with scramble siRNAs (Figure 6c). [score:4]
To validate the predicted miR-25 -binding sites, luciferase reporter assay was performed, which showed that miR-25 overexpression resulted in a significant decrease in luciferase activity, whereas the opposite effect was observed when this miRNA was inhibited (Figure 5b). [score:4]
Next, we compared miR-25 and MALAT1 expression following transfection of NPC cells with an RBM24 overexpression vector versus a control vector. [score:4]
This increase may have been due to the inhibition of miR-25 function in the RBM24 -induced cells following Ago2 knockdown. [score:4]
These 23 miRNAs were sorted in descending order according to their fold changes, and miR-25 was ranked the highest out of all of the common upregulated genes. [score:4]
Transwell assays revealed that miR-25 overexpression suppressed the migration and invasion abilities of the 5-8 F and CNE-2 Tet-Off-inducible RBM24-stable cells (Figure 4d). [score:4]
[34] Based on these results, we used a miRNA-lncRNA interaction analysis program, starBase v2.0, which employs a database containing a large set of Ago and RBP binding sites derived from all available CLIP-Seq experimental techniques, to screen for potential lncRNAs targeted by miR-25. [score:3]
Altogether, these results suggest that MALAT1 is a target of miR-25. [score:3]
[46] Similarly, an elevated miR-25 level in NPC cells has been associated with the significant inhibition of cell proliferation, migration and invasion. [score:3]
The results showed that 33 lncRNAs were possible targets of miR-25 (Supplementary Table S2). [score:3]
In addition, similar results were obtained from correlation analysis among the expression levels of RBM24, miR-25, and MALAT1 in the primary NPC fresh tumor tissues (Supplementary Figure S5). [score:3]
We also observed a negative association between miR-25 and MALAT1 expression (P=0.005, r=−0.6647). [score:3]
The siRNAs, miR-25 mimic, miR-25 inhibitor and scrambled negative control were purchased from Ribobio Co (Guangzhou, China). [score:3]
[41] Previous reports have demonstrated that miR-25 is overexpressed in a number of cancers, including gastric, lung, liver and ovarian cancers. [score:3]
Next, we investigated whether miR-25 overexpression has suppressive effects on migration and invasion. [score:3]
Further, qRT-PCR analysis of three Tet-Off-inducible RBM24-stable cells showed that the induction of RBM24 expression significantly increased the miR-25 level (Figure 4b). [score:3]
MiR-25 directly targets the lncRNA MALAT1. [score:3]
In contrast, miR-25 inhibitor significantly restored the MALAT1 RNA level in RBM24 -induced cells (Figure 5d). [score:3]
Briefly, pMIR-REPORT-MALAT1 or pMIR-REPORT-MALAT1-mut was cotransfected with miR-25 mimic, inhibitor, or the corresponding negative control into 5-8 F and CNE-2 cells by Lipofectamine -mediated gene transfer. [score:3]
Moreover, mutation of the predicted miR-25 -binding sites abolished this effect (Figure 5b). [score:2]
Furthermore, we found that MALAT1 expression was significantly reduced by transfection with miR-25 mimic compared with negative control miRNA mimic (NC mimic) (Figure 5c). [score:2]
As shown in Figure 4c, CCK8 assay revealed that the ectopic expression of miR-25 slowed the propagation of NPC cells. [score:2]
MiR-25 suppresses the proliferation, migration and invasion of NPC cells. [score:2]
In this study, we searched a database of miRNA-lncRNA interactions using starBase v2.0 [47] and found that miR-25 bound to numerous lncRNAs. [score:1]
Two putative miR-25 binding sites in the MALAT1 RNA were cloned downstream of the cytomegalovirus (CMV) promoter in a pMIR-REPORT vector (Ambion, Carlsbad, CA, USA). [score:1]
Interestingly, a well-known oncogenic lncRNA, MALAT1, was the most common among 33 lncRNAs that were bound by miR-25 in all cancers. [score:1]
Next, we used RNA hybrid programs to identify two putative binding sites for miR-25 in the MALAT1 sequence (NR_002819.2) at positions 640 and 2857 (Figure 5a and Supplementary Figure S3). [score:1]
The final tumor weights and photographs of the isolated tumors are shown in Figures 7e and f. To further investigate the correlations between RBM24, miR-25 and MALAT1 expression in vivo, we performed qRT-PCR to determine the RBM24, miR-25 and MALAT1 RNA levels in the xenografted tumors. [score:1]
[1 to 20 of 48 sentences]
3
[+] score: 162
Other miRNAs from this paper: hsa-mir-93, hsa-mir-106b
Li Q et al. found that the expression of miR-25 was down-regulated in colon cancer, and miR-25 might suppress the proliferation and migration of colon cancer cells as a tumor suppressor gene in vitro and in vivo [24]. [score:10]
The expression of miR-25 was significantly upregulated in HCC tissues (mean relative expression level: 8.287, SD=4.711) when compared with adjacent normal tissues(mean relative expression level: 4.177, SD=2.386, P<0.0001, Figure  1). [score:9]
Overexpression of miR-25 in ovarian cancer cells enhanced cell proliferation whereas down-regulation of miR-25 induced apoptosis. [score:6]
Previous studies have shown that the expression of miR-25 was up-regulated significantly in human stomach cancer, ovarian cancer, and prostate cancer [16- 18]. [score:6]
The expression of miR-25 was significantly upregulated in HCC tissues when compared with adjacent normal tissues (p<0.0001). [score:5]
Overall survival rate in patients with high miR-25 expression was significantly lower than that in patients with low miR-25 expression (p=0.0192). [score:5]
Patients who had high miR-25 expression had a shorter overall survival than patients who had low miR-25 expression (median overall survival, 31.0 months versus 42.9 months, p=0.0192). [score:5]
The results indicated that patients who had high miR-25 expression had a shorter overall survival than patients who had low miR-25 expression (median overall survival, 31 months versus 42.9 months, p=0.0192; Figure  2). [score:5]
The relationship between miR-25 expression level with clinicopathological variables of HCC patients was shown in Table  1. The relative miR-25 expression levels were significantly positively correlated with serum AFP (p=0.02) and TNM stage (p=0.01). [score:5]
Accumulating evidence has shown that up-regulation of miR-25 is associated with the prognosis of several human malignant solid tumors, including those of the stomach, ovary and prostate [16- 18]. [score:4]
Accumulating evidence has shown that up-regulation of microRNA-25(miR-25) is associated with the prognosis of several types of human malignant solid tumors. [score:4]
In the study by Li Y et al., knock-down studies for the miR-106b-25cluster, which includes miR-106b, miR-93 and miR-25, showed that the expression of the cluster was necessary for cell proliferation and for anchorage independent growth [19]. [score:4]
Zhang H et al. have found that miR-25 was strongly up-regulated in ovarian cancer tissue versus adjacent non-tumor tissue. [score:4]
Additional studies are needed to more clearly and comprehensively articulate the molecular mechanisms of both the cause and the effects of altered expression of miR-25 in the development and/or progression of HCC. [score:4]
However, investigators also found that expression of miR-25 was down-regulated in other cancer. [score:4]
To confirm this possibility, the miR-25 expression level and the prognosis of patients with HCC were analyzed by using the Kaplan–Meier method. [score:3]
Considering that the level of miR-25 expression was significantly correlated with TNM stage and serum AFP level, we hypothesized that miR-25 might affect the prognosis of HCC patients. [score:3]
However, the clinical significance of miR-25 gene expression in HCC remains unclear. [score:3]
However, the precise molecular mechanisms behind the altered expression of miR-25 in HCC and its function are not very clear. [score:3]
The correlation between the expression level of miR-25 and clinicopathological characters was assessed with the two-sample Student’s t test. [score:3]
Analysis using the two sample Student’ s t test showed that the relative expression levels of miR-25 in the hepatocellular carcinoma tissues were significantly higher than those in adjacent normal tissues (p<0.0001) SE, Standard Error. [score:3]
However, the clinical relevance of miR-25 has not been studied yet, and whether miR-25 expression has influence on the prognosis of HCC is still unknown. [score:3]
The high expression of miR-25 in gastric carcinoma tissues may be a high risk factor associated with tumor penetration through serosa, lymph node metastasis, distant metastasis, and poor long-term survival in patients undergoing radical resection and adjuvant systemic chemotherapy [16]. [score:3]
However, whether miR-25 expression has influence on the prognosis of hepatocellular carcinoma (HCC) is still unknown. [score:3]
The present findings demonstrate high expression of miR-25 in HCC tissue, which is associated with a poor prognosis in HCC patients. [score:3]
However, there was no significantly correlation of miR-25 expression with other clinical features such as gender (p=0.62), age (p=0.21), liver cirrhosis (p=0.17), Hepatitis B virus infection (p=0.09), vein invasion (p=0.24), tumor diameter (p=0.13), or number of tumor nodules (p=0.51). [score:3]
The multivariate Cox regression analysis indicated that miR-25 expression (HR=2.179; p=0.001), TNM stage (HR=1.782; p=0.014), and vein invasion (HR=1.624; p=0.020) were independent prognostic factors for overall survival (shown in Table  2). [score:3]
Figure 1 Comparison of miR-25 expression levels between hepatocellular carcinoma tissues and adjacent normal tissues. [score:3]
Li Y et al. have found that miR-25 was strongly up-regulated in HCC tissue when compared with the corresponding paired non-tumor samples. [score:3]
Our data suggests that the overexpression of miR-25 in HCC tissues is of predictive value on poor prognosis. [score:3]
In summary, to the best of our knowledge, the present study is the first to report the differential expression of miR-25 in HCC and the possible use of miR-25 as a novel prognostic marker in HCC. [score:3]
In the study by Kim BH et al., miR-25 was found to be up-regulated in human gastric carcinoma tissues when compared to adjacent non-neoplastic tissues. [score:3]
The multivariate Cox regression analysis indicated that miR-25 expression (HR=2.179; p=0.001), TNM stage (HR=1.782; p=0.014), and vein invasion (HR=1.624; p=0.020) were independent prognostic factors for overall survival. [score:3]
The expression levels of miR-25 correlate with prognosis of patients with HCC. [score:3]
More importantly, we proved that patients with a high expression of miR-25 tended to have shorter survival than patients with lower levels, indicating that high miR-25 level is a marker of poor prognosis for patients with HCC. [score:3]
In the present study, we found that miR-25 expression was proven to be associated with advanced TNM stage, suggesting that miR-25 might be involved in the carcinogenesis and metastasis of HCC. [score:3]
The comparison of the expression level of miR-25 between HCC tissues and adjacent normal tissues was performed using the two-sample Student’s t test. [score:3]
The differentially expressed amount of the miR-25 was validated in triplicate by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). [score:3]
The expression levels of miR-25 in ovarian cancer cell lines were similar with ovarian cancer samples compared with the normal ovarian epithelial cells. [score:2]
Further studies are needed to elucidate the mechanisms of action of miR-25 in HCC. [score:1]
The expression level of miR-25 in HCC samples and its relationship with clinicopathological characteristics. [score:1]
RNA isolation and quantitative RT-PCR of miRNA-25. [score:1]
Patient characteristics were shown in Table  1. Table 1 Relationship between miR-25 expression level and clinicopathologic parameters of hepatocellular carcinoma Factor No. [score:1]
The effects of miR-25 abrogation were partly mediated by the intrinsic apoptosis pathway. [score:1]
MiR-25 is a member of the miR-106b~25 cluster, which includes miR-106b, miR-93 and miR-25, that is located within intron 13 of the minichromosome maintenance protein 7 (MCM7) gene on chromosome 7q22.1 [14]. [score:1]
Patient characteristics were shown in Table  1. Table 1 Relationship between miR-25 expression level and clinicopathologic parameters of hepatocellular carcinoma Factor No. [score:1]
MiR-25 is a member of the miR-106b~25 cluster, which includes miR-106b, miR-93 and miR-25, that is located within intron 13 of the minichromosome maintenance protein 7(MCM7) gene on chromosome 7q22.1 [14, 15]. [score:1]
The 2 [-ΔCT] (ΔC [T]=C [TmiR25]-C [TU6 RNA]) method was used to quantify relative amount of miR-25. [score:1]
320Hepatitis B virus infectionPositive/negative1.0020.892-1.3370.417 Serum AFP level >25/≤25 1.377 0.882-1.335 0.398 CI, confidence interval; HR, hazard ratio; miR-25, microRNA-25. [score:1]
Therefore, we speculate that the function of miR-25 is tissue specific. [score:1]
[1 to 20 of 50 sentences]
4
[+] score: 149
Other miRNAs from this paper: mmu-mir-25, hsa-mir-451a, mmu-mir-451a, hsa-mir-451b, mmu-mir-451b
Further, downregulation of microRNA-25-5p (“miR-25-5p”), a PKCζ -targeting miRNA [24], could be the cause of PKCζ upregulation in CRC cells. [score:9]
We here showed that expression of miR-25-5p inhibited CRC cell proliferation possibly via downregulating PKCζ. [score:8]
In the current study, we showed that miR-25-5p, an anti-PKCζ miRNA [24], was downregulated in human colon cancer tissues and CRC cells, which could be the cause of PKCζ upregulation. [score:7]
miR-25-5p downregulation could therefore be the cause of PKCζ upregulation. [score:7]
On the other hand, PKCζ silence, by targeted-shRNA or miR-25-5p expression, activates AMPK and inhibits HT-29 cell proliferation. [score:7]
Notably, PKCζ mRNA upregulation and miR-25-5p downregulation were also noticed in other established CRC cell lines, including HCT-116, Lovo, SW403 and SW48 (Supplementary Figure 1). [score:7]
HT-29 xenograft growth in SCID mice is inhibited after expressing or miR-25-5p. [score:5]
HT-29 xenograft growth in mice is inhibited after expressing or miR-25-5p. [score:5]
Remarkably, forced exogenous expression of miR-25-5p silenced PKCζ, activated AMPK and inhibited HT-29 cell proliferation. [score:5]
Exogenous expression of miR-25-5p silences PKCζ and inhibits HT-29 cell proliferation. [score:5]
More importantly, in vivo growth of HT-29 xenografts was largely suppressed after expressing miR-25-5p. [score:5]
Weekly tumor growth curve result in Figure 4A demonstrated that the in vivo growth of HT-29 xenografts was significantly inhibited after expressing the or miR-25-5p. [score:5]
As demonstrated, miR-25-5p level was dramatically downregulated in colon cancer tissues (Figure 1C), and its level was relatively high in the surrounding normal tissues (Figure 1C). [score:4]
These results indicate that PKCζ could be the direct and primary target of miR-25-5p in HT-29 cells. [score:4]
Meanwhile, downregulation of PCNA (a proliferation marker) and induction of cleaved-PARP (an apoptosis marker) were observed in tumor tissues with or miR-25-5p (Figure 4C) Therefore, the in vivo signaling changes were in line with the in vitro findings. [score:4]
It is certainly possible that other targets of miR-25-5p could also be involved in above actions. [score:3]
To support this hypothesis, the pre-miR-25 -expressing vector (“miR-25-Vec”, a gift from Dr. [score:3]
For instance, several potential miR-25’s targeted genes have been identified thus far in cancer cells, including the apoptosis protein Bim [48] and mitochondrial calcium uniporter [49]. [score:3]
miR-25-5p -mediated silence of PKCζ, on the other hand, resulted in LKB1 activation and sustained/intensified AMPK activation, which should inhibit CRC cell proliferation. [score:3]
Forced miR-25 expression. [score:3]
In line with previous findings [24], expression of miR-25-5p was significantly elevated in the two lines (Figure 3A). [score:3]
Expressions of above signaling proteins and miR-25-5p were also examined in human CRC cancer cells. [score:3]
The pSuper-neo pre-miR-25 expression vector (“miR-25-Vec”) was provided by Dr. [score:3]
Via selection, two stable HT-29 cell lines expressing miR-25-Vec were established, named as “miR-25-Vec-L1” and “miR-25-Vec-L2”. [score:3]
Exogenous expression of miR-25-5p led to a dramatic reduction of PKCζ mRNA UTR luciferase activity (Figure 3B). [score:3]
We thus tested miR-25-5p expression in above human tissues. [score:3]
Expressions of listed genes and miR-25-5p in fresh tissue lysates were examined. [score:3]
miR-25-5p is a recently-indentified PKCζ -targeting miRNA [24], its level was negatively correlated with PKCζ level in human colon cancer tissues and CRC cells (Figure 1). [score:3]
Collectively, we confirmed, which was correlated with AMPK inhibition, mTORC1 activation and miR-25-5p depletion. [score:3]
Further studies will be needed to identify possible other targets of miR-25-5p in CRC cells. [score:3]
Mature miR-25-5p expression in the stable cells was always tested by the qRT-PCR assay (Method was descried early [50]). [score:2]
Stable HT-29 cells, expressing pre-miR-25 -expressing vector (“miR-25-Vec”, “L1/L2”) or empty vector (“Vec”), as well as the parental control HT-29 cells (“Par”) were subjected to qRT-PCR (A and C) assay, PKCζ mRNA UTR luciferase activity assay (B) and (D); proliferation of above cells was tested by viable cell counting assay (E) and BrdU ELISA assay (F). [score:1]
miR-25-5p level was also decreased in the CRC cells (Figure 1F). [score:1]
The potential effect of or miR-25-5p on CRC cell growth in vivo was tested next. [score:1]
miR-25-3p level was not changed in these cells (Data not shown), suggesting that miR-25-5p could be the primary product of the vector (reported in [24]). [score:1]
A very recent study by Fan et al., has characterized a PKCζ -targeting miRNA, miR-25-5p [24]. [score:1]
The UTR reporter vector that contains the 3′-UTR of PKCζ carrying the miR-25-5p site was provided again by Dr. [score:1]
Figure 3Stable HT-29 cells, expressing pre-miR-25 -expressing vector (“miR-25-Vec”, “L1/L2”) or empty vector (“Vec”), as well as the parental control HT-29 cells (“Par”) were subjected to qRT-PCR (A and C) assay, PKCζ mRNA UTR luciferase activity assay (B) and (D); proliferation of above cells was tested by viable cell counting assay (E) and BrdU ELISA assay (F). [score:1]
Expressions of protein kinase C ζ (PKCζ) mRNA (A and D, qRT-PCR assay), listed proteins (B and E,) and microRNA-25-5p (“miR-25-5p”, C and F, qRT-PCR assay) in fresh human colon cancer tissues (“Tum”, N=10) and surrounding normal colon tissues (“Nor”), as well as in the FHC colon epithelial cells (“Epi”) and human CRC cells (HT-29 and DLD-1) were shown. [score:1]
TaqMan microRNA assay system was applied to detect miR-25-5p expression using the described primer [53]. [score:1]
Figure 4Same amount (five million cells per mouse) of HT-29 cells, bearing (1#) or miR-25-5p (“L1”) as well as the parental control HT-29 cells (“Par”) were inoculated s. c. to the SCID mice. [score:1]
These results imply that miR-25-5p could be an anti-cancer miRNA in CRC cells. [score:1]
The construct was then co -transfected with miR-25 vector into HT-29 cells. [score:1]
Same amount of HT-29 cells, bearing (“1#”, see Figure 2), miR-25-5p (“L1”, see Figure 3) or the parental control HT-29 cells (“Par”, or control tumors) were inoculated to the SCID mice via s. c. injection. [score:1]
Figure 1Expressions of protein kinase C ζ (PKCζ) mRNA (A and D, qRT-PCR assay), listed proteins (B and E,) and microRNA-25-5p (“miR-25-5p”, C and F, qRT-PCR assay) in fresh human colon cancer tissues (“Tum”, N=10) and surrounding normal colon tissues (“Nor”), as well as in the FHC colon epithelial cells (“Epi”) and human CRC cells (HT-29 and DLD-1) were shown. [score:1]
Same amount (five million cells per mouse) of HT-29 cells, bearing (1#) or miR-25-5p (“L1”) as well as the parental control HT-29 cells (“Par”) were inoculated s. c. to the SCID mice. [score:1]
[1 to 20 of 46 sentences]
5
[+] score: 120
Upstream inhibitors like miR-1 besides downstream inhibitors like miR-25 thus show interesting properties for anti-cancer treatments in Wnt -dependent cancers and further support current findings that upstream components of the Wnt pathway are also valid and rational targets for cancer-therapies, even in cells with downstream mutations [15], [54], [55]. [score:8]
Curiously the effect of hsa-miR-25 on β-catenin seems to be more effective under conditions of high pathway and low destruction complex activity, when translational differences preponderate and come into play due to strongly reduced post-translational regulation of β-cat. [score:6]
Deregulated miR expression profiles might also contribute to oncogenesis by repressing the tumor suppressors, p21/p53 (miR-25 [42], [43], miR-504 [44]) which in turn might affect Wnt signaling. [score:6]
Analyses of miR-25 function in the regulation of the Wnt pathway suggests a potential function in the translational inhibition of β-catenin via its binding to the β-catenin coding sequence and not its 3′-UTR. [score:6]
Additionally, expression of Pri-miR-25 in SW480 colon cancer cells, that exhibit high Wnt/β-catenin activity due to an APC truncation, significantly inhibited both the STF Wnt-reporter activity by ∼40% (Fig. 3D) and β-catenin protein levels by 20% (Fig. 3C). [score:5]
Intriguingly, miR-32, that inherits the same seed as miR-25 also targets Pcaf [52] but instead, upregulates the Wnt-reporter in our reporter assays (Fig. S4). [score:5]
Recent evidence also suggests that miR-25 may inhibit Wnt/β-catenin dependent cancer viability by targeting Pcaf [52] which binds, acetylates, stabilizes and activates β-cat [53], thereby corroborating our observation that the influence of miR-25 is likely at the level of β-cat. [score:5]
Epistasis experiments revealed that miR-1 and miR-613 target the pathway upstream of Axin or active β-catenin, and that miR-25 acts downstream, at the level of β-cat, likely by targeting β-cat's coding sequence. [score:5]
Importantly, overexpression of miR-25 and miR-1 inhibited proliferation/viability of human colon cancer cells that are known to be dependent on sustained β-cat signaling for their survival [22], [24]. [score:5]
All miRs down-regulated Wnt3a-CM and LiCl induced Wnt pathway activity, while only Pre-miR-25 was able to repress Axin1+2-siRNAs or β-catenin-S37A induced activity. [score:4]
These observations suggest that the coding sequence of β-catenin itself may be the primary and direct target of miR-25. [score:4]
To test whether miR-25 could directly target the β-catenin cDNA, a fragment of the β-catenin coding sequence (CDS) containing the potential miR-25 binding sites was cloned into the psi-check-2 reporter. [score:4]
Elevated reporter activity by simultaneous siRNA mediated knockdown of Axin1 and Axin2 could be strongly inhibited by transfection of Pre-miR-25 (P<0.05; unpaired t-test), while miR-1 and miR-613 showed no significant influences (P>0.05). [score:4]
As experiments revealed no significant change in β-catenin transcript levels for all three miRs (Fig. S7), one remaining possibility is that miR-25 represses translation of β-catenin but not its transcript level. [score:3]
A downstream role of miR-25 is also in agreement with a Drosophila miR-25/92 evolutionarily related cluster (Fig. S2) that can target the Wnt/Wg pathway (Pancratov and DasGupta, unpublished data). [score:3]
Secondary validation and functional testing of 3 candidate miRs, namely miR-1, miR-25 and miR-613 confirmed their inhibitory effect on the activity of the Wnt pathway. [score:3]
The coding region of human β-catenin (S37A mutant; transcript nt position 307–1874 NcoI-Klenow; NotI) was subcloned into the 3′UTR of the Renilla gene (NotI, SpeI-Klenow) within a psi-check-2 reporter vector with modified MCS to monitor the influence of miR-25 on its transcript stability and translation. [score:3]
Notably, not only synthetic Pre-miR-25 but also over -expression of Pri-miR-25 could reduce a normalized Renilla gene activity with the β-catenin-CDS-fragment-3′UTR but to a lesser degree. [score:3]
Intriguingly the most stringent RNAhybrid predictions that allow non-canonical seed sequences indicated some potential binding sites of miR-25 in the β-catenin cDNA (Fig. S5), while other target prediction algorithms (PicTar, EMBL-Microcosm, etc. ) [score:3]
While miR-1 and miR-613 could slightly reduce Wnt3a-CM mediated induction of β-catenin protein levels in HEK293 cells, miR-25 and miR-613 expression resulted in a moderate (∼20%) reduction in LiCl induced total β-catenin protein level, (Fig. 3B). [score:3]
Expression of miR-25 repressed the psi-check2 sensor containing the miR-25 binding site, and moderately reduced β-catenin protein levels, while β-catenin transcript levels remained unchanged. [score:3]
This was particularly evident in HT-29 cells where despite several attempts we could not generate HT29-pcDNA3.1(-)-hsa-miR-25 expressing stable cell lines, although a few pcDNA3.1(-) empty vector transfected clones survived the selection procedure (Fig. 3F). [score:3]
Additionally, only miR-25 inhibited the activity of degradation-resistant S37A β-catenin mutant on the STF reporter (Fig. 3 A). [score:3]
Taken together, these data suggest that miR-25 represses the Wnt pathway downstream of GSK3β, Axin1/2 and stabilized β-catenin, while miR-1 and miR-613 act upstream of Axin1/2 and stabilized β-catenin but probably downstream of LiCl -mediated inhibition of GSK3β. [score:3]
Relative amount of cells obtained after the selection procedure to establish HCT116, SW480, and HT29 colorectal cancer cell lines expressing Pri-miR-25-pcDNA3.1(-)-Neomycin compared to empty vector control cells. [score:2]
Upon transfection of colon cancer cells (HCT116, HT29, SW480) with Pri-miR-25 expressing vector, the number of Pri-miR-25 stable cell-colonies was markedly reduced compared to empty vector controls (Fig. 3F). [score:2]
HPLC grade human synthetic Pre-miR™ precursor miRNAs that are strand-selection optimized/approved and chemically modified siRNA-like precursor miRs (Pre-miR-1™ #AM17100; Pre-miR-25™ #AM17100; Pre-miR-613™ #AM17100) were purchased from Ambion. [score:1]
3 out of 38 candidate miRs (miR-1, miR-25, miR-613) were further characterized in Wnt-responsive cultured cells and all were validated for their Wnt -inhibitory properties identified in the initial screen. [score:1]
Pre-mir-1 may function most upstream, followed by miR-613 and then miR-25, which seems to influence the most downstream activity at the level of β-catenin. [score:1]
Renilla gene activity with an inserted β-catenin CDS in the 3′UTR indicated a significant miR-25 -dependent reduction while control siRNAs, miR-1 or miR-613 had no effect (Fig. 3E). [score:1]
Phylogenetic analysis support the miR-base classification that miR-1 belongs to the miR-1/206 family including hsa-miR-206 and the Drosophila dme-miR-1, an indication of the high evolutionary conservation of this family (shown in Supplementary, Fig. S2A by alignments and phylogenetic quartette puzzling trees); hsa-miR-25 belongs to the evolutionary conserved miR-25/92 family [39] including Drosophila miR-92a+b/310/311/312/313, shown in Fig. S2B, and shares only the seed sequence with other miRs like miR-4325 or miR-367. [score:1]
Additionally, the opposite effects of miR-25 and miR-32 on the Wnt reporter may imply an important and distinguishing role for the co-seed sequence of miR-25, which is strongly divergent between miR-25 and miR-32 (Fig. S4). [score:1]
On the other hand miRs like miR-32 or 367 that shares the seed with the miR-25/92 family could not repress Wnt reporter activity (Fig. S4). [score:1]
Figure S4 Screening results and alignment of studied miRs (miR-1/206 and miR-25/92 family) and miRs with a similar seed sequence. [score:1]
Secondary validation of miR-1, miR-25 and miR-613. [score:1]
0026257.g003 Figure 3 (A) Epistasis experiments with synthetic human Pre-miR-1, Pre-miR-25 and Pre-miR-613. [score:1]
In order to investigate the function of miR-25 in Wnt-responsive cell lines we cloned a human unprocessed Pri-miR-25 into the pcDNA3.1(-) expression vector with a selectable neomycin marker. [score:1]
Selection media for cells transfected with linearized empty pcDNA3.1(-) or Pri-hsa-miR-25 pcDNA3.1(-) using Lipofectamine2000 contained increasing amounts of active G418 sulfate (Cellgro #30-234-CR) for 7–16 days. [score:1]
The epistasis experiments indicated that miR-25 may act in parallel or downstream of β-catenin itself. [score:1]
Figure S5 Possible miR-25 binding sites in β-catenin CDS (543–1874) predicted with RNAhybrid and without seed sequence constraints to include non-canonical seed identification. [score:1]
After sub-cloning the hsa-Pri-miR-25 amplicon that contains endogenous 5′- and 3′-flanking sequences was finally cloned into the pcDNA3.1(-) vector (Invitrogen) via BamHI (vector and insert) and NheI (vector) XbaI (insert). [score:1]
This could indicate that some miRs or miR-families may repress the Wnt pathway components/activity mainly with the seed sequence (miR-1/613 -family), while others may require the coordinated action of the seed and co-seed (miR-25/92 -family). [score:1]
[1 to 20 of 42 sentences]
6
[+] score: 118
Ingenuity Pathway Analysis (IPA, QIAGEN) was implemented to analyze all genes significantly downregulated by miR-25 mimic treatment, identifying various enriched pathways, as shown, that significantly correlate with miR-25 overexpression. [score:6]
Intringuingly, out of the 12 validated miRNA hits, five (miR-148a, miR-17-5p, miR-25, miR-130a, and let-7a) were significantly downregulated by HCV, while others were also suppressed, but to a lesser extent (Fig.   2e). [score:6]
For all 12 HCV -associated miRNAs, the lists of computationally predicated cellular targets which are known HCV host factors are shown in Supplementary Data  6. Since miRNAs regulate gene expression predominantly through mRNA degradation [3], we performed a microarray analysis and assessed global transcriptome changes in Huh7.5.1 cells transfected with miR-25 mimic. [score:6]
For all 12 HCV -associated miRNAs, the lists of computationally predicated cellular targets which are known HCV host factors are shown in Supplementary Data  6. Since miRNAs regulate gene expression predominantly through mRNA degradation [3], we performed a microarray analysis and assessed global transcriptome changes in Huh7.5.1 cells transfected with miR-25 mimic. [score:6]
Thus, miR-25 selectively inhibits the expression of two essential HCV host factors, HIPK3 and SUV420H1, to block HCV assembly and production (Supplementary Fig.   7g). [score:5]
NS not significant To identify the cellular targets of let-7a that may mediate its antiviral effects, we applied the same algorithm employed for defining miR-25 targets (Supplementary Fig.   9a). [score:5]
On the contrary, transfection of miR-25 hairpin inhibitor significantly elevated part-two core protein expression, level of extracellular viral RNA, and infectious HCV production (Fig.   4a–c). [score:5]
NS not significant To identify the cellular targets of let-7a that may mediate its antiviral effects, we applied the same algorithm employed for defining miR-25 targets (Supplementary Fig.   9a). [score:5]
miR-25 targets the late steps of HCV infection as overexpression of miR-25 in Huh7.5.1 cells drastically diminished HCV core protein production in part two (Fig.   4a). [score:5]
Moreover, production of infectious HCV in the supernatant was inhibited by overexpressing miR-25 (Fig.   4c), the level of which was markedly increased by transfection of its mimic (Supplementary Fig.   6a). [score:5]
Bioinformatics -based target prediction, in line with assessing phenotypic effects on HCV infection and global transcriptome analysis, derived two phenotypic-specific miR-25 target candidates. [score:5]
We showed that HIPK3 and SUV420H1 3′-UTR activities were significantly inhibited by miR-25 mimic transfection, indicating that these 3′-UTRs are subject to miR-25 regulation (Fig.   4g). [score:4]
Interestingly, miR-25, miR-130a/b, and let-7a—three most relevant antiviral miRNAs physiologically interacting with HCV—are downregulated by the virus, demonstrated in both cultured cells and liver tissues of CHC patients. [score:4]
After 24 h, the media was replaced with Transduction Medium (DMEM (4.5 g/L glucose, Sodium Pyruvate, 25 mM HEPES, no L-Glut) with 10% FBS, and Polybrene (AmericanBio) at a concentration of 4 µg/mL] combined with either the active control (SMARTvector Non -targeting hCMV-TurboGFP Control), miR-130a (shMIMIC Human Lentiviral microRNA has-miR-130a-3p hCMV-TurboGFP), miR-25 (shMIMIC Human Lentiviral microRNA has-miR-25-3p hCMV-TurboGFP), or let-7a (shMIMIC Human Lentiviral microRNA has-let-7a-5p hCMV-TurboGFP) (GE Dharmacon). [score:3]
However, we cannot completely rule out that miR-25 may regulate HIPK3 and SUV420H1 in an indirect manner. [score:3]
f Schematics for systematic identification of potential miR-25 targets. [score:3]
27 of the predicted miR-25 targets were previously linked to HCV infection [9], and thus were selected for validation (Fig.   4f). [score:3]
miR-25 expression seems to be unrelated to the extent of liver fibrosis—assessed by Ishak score (Supplementary Fig.   6d). [score:3]
In the liver tissues of chronic hepatitis C (CHC) patients, miR-25 expression level was significantly lower than those of normal livers (Fig.   4e). [score:3]
To gain further insight into the biological activities of miR-25, we surveyed cellular targets through which miR-25 may deploy its antiviral functions. [score:3]
Infection of Huh7.5.1 cells with shMIMIC lentiviral miR-25 inhibited HCV infection in a lentiviral MOI -dependent manner (Supplementary Fig.   6b, c), confirming miR-25’s gain-of-function effect. [score:3]
a– c Effects of miR-25 mimic or hairpin inhibitor on production of HCV core protein (a), viral RNA (b), and infectious HCV (c). [score:3]
i Bioinformatics analysis of miR-25 targeted molecular pathways, derived from microarray -based transcriptome dataset comparing miR-25 mimic -transfected cells with mimic control -treated cells (Supplementary Data  7). [score:3]
miR-25 mimic transfection also led to a more profound inhibitory effect on the secreted HCV RNA level than that of intracellular viral RNA (~4-fold vs. [score:3]
We further confirmed by qPCR that miR-25 overexpression reduced their mRNA levels in Huh7.5.1 cells (Fig.   4h), consistent with the microarray results (Supplementary Data  7). [score:3]
We uncovered multiple miRNAs as regulators of HCV infection, including the miR-25, let-7, and miR-130 families. [score:2]
We showed that unlike miR-122 and miR-196a, which predominantly act on the early stages of HCV infection, miR-17-5p or miR-25 had no effect on HCVsc infection (Fig.   3d), validating their roles in the late stages only. [score:1]
g, h miR-25 mimic transfection abates 3′-UTR activities (g) and mRNA levels (h) of HIPK3 and SUV420H1. [score:1]
Huh7.5.1 cells were transfected with miRNA mimic control or let-7a, miR-130a, or miR-25 mimic at 25 nM for 72 h, in triplicate. [score:1]
Among them, three are proviral miRNAs (miR-122, miR-151-5p, and miR-17-5p), and nine others, including let-7a, let-7b, miR-130a, miR-148a, miR-181a, miR-196a, miR-30a-5p, miR-99b, and miR-25, are antiviral factors (Fig.   2c). [score:1]
Bioinformatics analyses demonstrated that miR-25 possesses a seed sequence match site at the 3′ UTR of each gene (Supplementary Fig.   7b). [score:1]
let-7a, miR-130a, miR-130b, and miR-25 expression levels were determined by qPCR using TaqMan Universal PCR Master Mix (Applied Biosystems) and specific miRNA primers and probes (TaqMan MicroRNA Assays, Applied Biosystems). [score:1]
Furthermore, through the two-part HCVcc infection assays, we uncovered miR-17-5p (proviral) and miR-25 (antiviral) as host dependencies that preferentially regulate the late stage of HCV infection—assembly or secretion. [score:1]
miR-25 impedes HCV assembly or secretion. [score:1]
These include SUV420H1 for miR-25; PPIA, IQCB1, IGF2BP1, and CLDN1 for let-7a; and DDX6, NPAT, LDLR, HCCS, and INTS6 for miR-130a. [score:1]
These data support miR-25’s role in the late stages of HCV life cycle (assembly or secretion). [score:1]
Next we dissected the functions and mechanisms of three miRNAs: miR-25, let-7a, and miR-130a in modulating HCV infection. [score:1]
We further dissected the functions and underlying mechanisms of three physiologically relevant miRNA families (miR-25, let-7, and miR-130) in modulating HCV infection. [score:1]
Interestingly, microarray -based transcriptome analysis of miR-25 mimic -treated cells also demonstrated that there is a significant enrichment of nuclear receptor activation pathways, including FXR/RXR, LXR/RXR, PXR/RXR, and PPARA/RXR pathways (Fig.   4i). [score:1]
[1 to 20 of 39 sentences]
7
[+] score: 103
Other miRNAs from this paper: hsa-mir-93, hsa-mir-106b
Consistent with this, our data showed that the upregulation of p21 and BIM by depletion of MYC could be partially reversed by miR-106b and miR-25, suggesting that miRNA involvement is one of the reasons for the upregulation of p21 and BIM by MYC-siRNA. [score:7]
In order to verify the alteration in expression level of this cluster, we used quantitative real-time PCR (qRT-PCR) to detect these three miRNAs in total RNA isolated from cultured ECC-1 and HEC-1A cells with or without TSA (100 ng/mL) for 24 h. The expressions of miR-106b, miR-93, and miR-25 were shown to be downregulated significantly in cells treated with TSA compared to control (Fig. 1D & C), consistent with our microarray results (Fig. 1C). [score:7]
According to previous reports, p21 and BIM are the direct targets and inhibited by miR-106b and miR-25, respectively [18]. [score:6]
BIM mRNA was upregulated in ECC-1 cells treated with TSA for 24 h, while it was not neutralized by miR-25, but its protein level was neutralized in miR-25 overexpressing ECC-1 cells. [score:6]
To certify the role of the miR-106b-93-25 cluster in the upregulation of p21 and BIM by TSA, the ECC-1 cells transfected with miR-106b or miR-25 mimics were cultured with or without TSA for 24 h, and then the mRNA and protein expression of p21 and BIM were analyzed by qRT-PCR ands, respectively. [score:6]
To corroborate these findings in EMC cells, a dual-luciferase reporter system was used to detect inhibition of p21 and BIM expression by miR-106b and miR-25 in ECC-1 cells, respectively. [score:5]
The expression of miR-106b, miR-93, miR-25 and their host gene MCM7 were upregulated in EMC tissues compared to the normal adjacent tissues. [score:5]
However, the mRNA level of BIM was only slightly reduced by miR-25 treatment (Fig. 3B), while its protein level was reduced significantly(Fig. 3C), indicating that repression of BIM may be mainly due to translational inhibition. [score:5]
Thus, p21 was directly regulated by miR-106b through the 3′UTR, while BIM was directly regulated by miR-25. [score:5]
This result suggested that TSA may regulate the expressions of miR-106b, miR-93, and miR-25. [score:4]
The miR-106b-93-25 cluster consists of three miRNAs, miR-106b, miR-93 and miR-25, and is located in the 13th intron of the minichromosome maintenance protein 7 (MCM7) gene of human chromosome 7. This miRNA cluster is upregulated in many human cancers, such as gastric, prostate, and pancreatic neuroendocrine tumors, The miRNAs of the miR-106b-93-25 cluster are co-transcribed in the context of the MCM7 primary transcript. [score:4]
Furthermore, similar changes were observed in the protein levels of BIM, the upregulation of protein level of BIM by TSA treatment was partially neutralized by miR-25. [score:4]
miR-106b, miR-93, miR-25 promoted the growth of ECC-1 cells, while their inhibitors significantly decreased proliferation in ECC-1 cells. [score:3]
Meanwhile, the apoptosis level increased significantly in the cells transfected with the miR-25 inhibitor. [score:3]
But the mRNA levels of BIM by TSA treatment were slightly changed in the cells overexpressing miR-25 or not(Fig. 4D). [score:3]
Apoptosis increased significantly in cells transfected with the miR-25 inhibitor. [score:3]
p21 and BIM are target genes of miR-106b and miR-25 respectively [18]. [score:3]
0045133.g003 Figure 3(a) pGL3 luciferase reporter constructs containing either the wild-type or mutant 3′UTR target sequence of miR-106b or miR-25 in the P21 or BIM gene were co -transfected into ECC-1 cells with either miRNA -negative control, miRNA mimics or empty pGL3 control vector (each n = 3). [score:3]
The miR-106b, miR-93 and miR-25 duplexes promoted cell proliferation compared with a control duplex, whereas their inhibitors significantly decreased proliferation of ECC-1 cells (Fig. 2A). [score:2]
In the presence of the wild-type BCL2L11 3′UTR, the miR-25 significantly inhibited the luciferase activity compared with vector control. [score:2]
The mutant 3′UTRs contained a point mutation in the miR-106b and miR-25 seed region complementary sites. [score:2]
Transcriptional inhibition of the luciferase reporter gene by either miR-106b or miR-25 was assayed in ECC-1 cells. [score:2]
Co-transfection of either miR-106b with the reporter construct containing the wild-type 3′UTR of p21 or miR-25 with the reporter construct containing the wild-type 3′UTR of BIM resulted in a significant inhibition of the luciferase reporters when compared with the miRNA negative control. [score:2]
We found the expressions of miR-106b, miR-93 and miR-25 were decreased in the group treated with TAM and TSA, while they were unchanged in the group treated with TAM only, compared with the control (Fig. 1C). [score:2]
We also constructed plasmids containing the p21-3′UTR with mutated seed regions for the predicted miR-106b/miR-93 binding sites (p21-mut-3′UTR), along with plasmids containing the BIM-3′UTR with mutated seed regions for the predicted miR-25 binding sites (BIM-mut-3′UTR). [score:1]
Cell numbers in G1 phase were reproducibly increased by anti- miR-106b and anti- miR-93 but were unchanged by anti- miR-25 (Fig. 2B). [score:1]
The proportion of cells transfected with miR-106b, or miR-93 in the G1 phase fell, while that of cells transfected with miR-25 remained unchanged (Fig. 2B). [score:1]
miR-25 gain of function decreased apoptosis of cells. [score:1]
When we examined the ECC-1 cells treated with TSA by flow cytometry, gain of miR-25 function was shown to decrease the apoptosis level in the cells. [score:1]
P21 mRNA was significantly decreased by miR-106b mimics while BIM mRNA was not significantly changed by miR-25 mimics. [score:1]
miR-25 gain of function had no effects on the cell cycle. [score:1]
The miR-106b-93-25 cluster is composed of the highly conserved miR-106b, miR-93, and miR-25 that have been shown to accumulate in different types of cancer, including gastric cancer [37], prostate cancer [38], and esophageal adenocarcinoma [39], hepatocellular carcinoma [40], and multiple myeloma [41]. [score:1]
We also measured the mRNA and protein levels of p21 and BIM after miR-106b and miR-25 overexpression. [score:1]
[1 to 20 of 33 sentences]
8
[+] score: 83
Other miRNAs from this paper: hsa-mir-30d, hsa-mir-210, hsa-mir-1285-1, hsa-mir-1285-2
Moreover, we checked miR-25 target genes through Mirwalk (a database which presents predicted and validated information on miRNA-target interaction [44]) and found that miR-25 may not directly regulate the expression of PGC-1α, TFAM and p53R2. [score:9]
Suppression of miR-25 expression dramatically increased p53 protein levels and mtDNA biogenesis gene expression. [score:7]
To investigate the role of miRNA in regulating p53 expression and genes regulating mitochondrial biogenesis, we transfected the miR-25 mimics, the miR -mimic negative control#1, the miR-25 inhibitor and the miR -inhibitor negative control#1 into 10 nM MeHg -treated ihNPCs, and examined the p53 protein levels by Western blot. [score:7]
We also found that miR-25 overexpression inhibited mtDNA biogenesis gene (PGC-1α, TFAM and p53R2) expression. [score:7]
In addition, we recently discovered that p53 was targeted by miR-1285, miR-25 and miR-30d through analysis using both bioinformatics tools (miRGen, TargetScan, Pictar, and Miranda) and the most current literature [25, 26, 27]. [score:5]
Interestingly, we found that miR-25 overexpression significantly reduced the protein expression of p53 in MeHg -treated ihNPCs. [score:5]
Moreover, we found that MeHg can inhibit miR-25 expression levels in ihNPCs. [score:5]
However, suppression of miR-25 expression dramatically increased p53 protein levels. [score:5]
ihNPCs were transfected with 30 nM of miR-25 mimics, miR -mimic negative control#1, miR-25 inhibitor or miR -inhibitor negative control#1 (Invitrogen). [score:5]
On the contrary, anti-miR-25 treatment led to an upregulation of p53 level, in which a 40% increase in p53 protein levels was observed (Figure 5b,c). [score:4]
As shown in Figure 5a, qPCR analysis revealed a significant MeHg -induced downregulation of the three miRNAs in ihNPCs (miR-30d fold change: 10 nM, 0.25 ± 0.02; 50 nM, 0.58 ± 0.04; miR-1285 fold change: 10 nM, 0.87 ± 0.11; 50 nM, 0.13 ± 0.01; miR-25 fold change: 10 nM, 0.68 ± 0.03; 50 nM, 0.78 ± 0.07). [score:4]
Marchi S. Lupini L. Patergnani S. Rimessi A. Missiroli S. Bonora M. Bononi A. Corra F. Giorgi C. de Marchi E. Downregulation of the mitochondrial calcium uniporter by cancer-related miR-25 Curr. [score:4]
On the contrary, anti-miR-25 treatment strongly enhanced the mRNA expression of PGC-1α, TFAM and p53R2 (Figure 5d–f). [score:3]
Therefore, we examined the changes in these miRNAs (miR-30d, miR-1285, miR-25), which may have a potential impact on p53 expression. [score:3]
We found that ectopic miR-25 overexpression leads to ~20% reduction in p53 protein levels. [score:3]
In addition, the mRNA expression of markers in mitochondrial biogenesis, such as PGC-1α, TFAM and p53R2, were significantly reduced in ihNPCs transfected with the miR-25 mimics. [score:3]
Low-Level MeHg Induces Genes Regulating Mitochondrial Biogenesis via miR-25. [score:2]
Taken together, our results suggest that low-dose MeHg -induced mitochondrial biogenesis is influenced by p53 via miR-25 in ihNPCs. [score:1]
To explore the functional significance of these miRNAs in MeHg -induced p53 expression, we chose miR-25 for further investigation. [score:1]
[1 to 20 of 19 sentences]
9
[+] score: 62
Recently, miR-25 has been shown to inhibit FBW7 expression and caused up-regulation of c-myc and KLF5 to promote reprogramming of mouse fibroblast cells to iPSCs (induced pluripotent stem cells) [191]. [score:8]
In addition, miR-25 has also been found to be highly expressed in ovarian cancer and regulates apoptosis through targeting pro-apoptotic Bim [189]. [score:6]
Another study showed that miR-25 could inhibit cell proliferation and colony formation through targeting oncogene EZH2 (enhancer of zeste 2) in thyroid carcinoma [186]. [score:5]
This study also revealed that miR-25 promoted ESCC migration and invasion via inhibiting E-cadherin expression [187]. [score:5]
Consistently, miR-25 promotes cell aggressiveness through down-regulation of desmpcollin-2 and subsequently redistributing adheren junctions and activating β-Catenin signaling in ESCC [188]. [score:4]
Moreover, microRNAs (miRNAs) including miR-27, miR-25 and miR-223 have been reported to be involved in regulating the expression of FBW7 [24- 27]. [score:4]
In contrast, miR-25 has been found to be up-regulated in esophageal squamous cell carcinoma (ESCC) tissues and associated with lymph node metastasis and TNM (Tumor, Node and Metastasis) stage. [score:4]
Moreover, miRNAs including miR-223, miR-27a, miR-25, and miR-129-59p can also regulate the expression of FBW7. [score:4]
For example, miR-25 was observed to be down-regulated in human colon cancer tissue. [score:4]
In addition, multiple microRNAs (miRNAs) such as miR-27a, miR-25, miR-129-5p, and miR-223 have also been demonstrated to regulate the expression of FBW7. [score:4]
Additionally, miR-25 promotes apoptosis resistance through targeting TNF-related apoptosis inducing ligand (TRAIL) death receptor-4 in cholangiocarcinoma [190]. [score:3]
Moreover, studies have shown that miR-25 could inhibit cell growth and migration through repression of Smad7 in colon cancer cells [185]. [score:3]
Several lines of evidence has defined that miR-25 is dysregulated in human cancers [182- 184]. [score:2]
3.7.3 by miR-25Several lines of evidence has defined that miR-25 is dysregulated in human cancers [182- 184]. [score:2]
Regulation of FBW7 by miR-25. [score:2]
However, further studies are warranted to explore whether miR-25 regulates FBW7 in cancer stem cells in the future. [score:2]
[1 to 20 of 16 sentences]
10
[+] score: 60
We found that miR-31-5p and miR-338-5p were up-regulated in S-IPF patients (p < 0.05), but down-regulated in AE-IPF patients (p < 0.05), while miR-25-3p and miR-92-3p were up-regulated in AE-IPF group, but down-regulated in S-IPF group. [score:13]
We were also able to show that miR-25-3p was down-regulated in S-IPF, but significantly up-regulated in AE-IPF, a new observation that indicates that S-IPF and AE-IPF are indeed separable molecularly. [score:7]
The expressions of these genes were predicted to be down-regulated by miR-25-3p in AE-IPF, which suggested a proliferative potential of cells. [score:6]
We found the intersections between the two miRNAs in cell cycle related processes in an opposite way, while let-7d-5p showed the suppressive effects on these processes, miR-25-3p promoted (Table  3). [score:3]
c ROC curve of combination of miR-25-3P and let-7d-5pas a biomarker for predicting AE-IPF from IPF DIANA-mirPath analysis was applied to predict the biologic targets and pathways as well as cellular processes that miR-25-3p and let-7d-5p affected. [score:3]
In this study, we reported that the human fibrosis-related miRNAs, miR-25-3p and let-7d-5p, were differentially expressed between S-IPF and AE-IPF. [score:3]
In conclusion, miR-25-3p and let-7d-5p in plasma were differentially expressed between AE-IPF and S-IPF. [score:3]
Targets of miR-25-3p involved in TP53, BCL2L11 and CDKN1C, etc. [score:3]
Idiopathic pulmonary fibrosis Acute exacerbation miR-25-3p let-7d-5p Idiopathic pulmonary fibrosis (IPF) is a progressive disease with steady worsening of symptoms and gas exchange. [score:3]
The specific large increase of miR-25-3p in AE-IPF, but reduced in S-IPF, suggested that the disease may have gained a pro-growth condition. [score:3]
Interestingly, two genes, ATP11A and OBFC1 found to be associated with IPF susceptibility in a GWAS study [29] were predicted as targets of miR-25-3p. [score:3]
Interestingly, in the same comparison, miR-25-3p was found to be significantly decreased in S-IPF group (p < 0.01), but increased greatly in AE-IPF group (p < 0.01). [score:1]
Fig. 2Concentration of miR-25-3p and let-7d-5p in plasma of AE-IPF, S-IPF and healthy controls. [score:1]
On the other hand, miR-25 has been found to be increased in various cancers and may act as an onco-miRNA [24– 28]. [score:1]
It will be highly interesting to study the association between the two genes and miR-25-3P in IPF pathogenesis. [score:1]
a ROC curve of miR-25-3p as a single biomarker for predicting AE-IPF from IPF. [score:1]
While miR-25-3p was obviously decreased in S-IPF (0.0002 ± 0.0001 vs 0.0003 ± 0.0003, P < 0.01) but significantly increased in AE-IP (0.0023 ± 0.002 vs 0.0003 ± 0.0003, P < 0.01). [score:1]
The various functional studies on the two miRNAs, miR-25-3p and let-7d-5p, should not be neglected. [score:1]
As a single biomarker, the AUC of miR-25-3p or let-7d-5p was 0.831 or 0.752 respectively, and the sensitivity of the combination of the two at fixed specificity of 90% was significantly improved, arguing a beneficial potential with the combination of the two miRNAs in AE-IPF determination, although the AUC value of the current combination of the miRNAs isolated in our study is still relatively low. [score:1]
The AUCs of miR-25-3p and let-7d-5p were 0.831 and 0.752, respectively. [score:1]
Fig. 3ROC curve analyses of plasma miR-25-3p and let-7d-5p as single markers and combined markers for predicting AE-IPF from IPF. [score:1]
[1 to 20 of 21 sentences]
11
[+] score: 51
We found hsa-miR-25 had more targets (top 5.0%, Additional file 2: Table S8) than most of others miRNAs collected in TargetScan but less targets in miRanda (top 60.0%, Additional file 2: Table S9), and hsa-miR-31 had a moderate number of target in both databases (top 36.8% and 32.8%, respectively). [score:9]
This distribution analysis uncovered that hsa-miR-25 regulated more targets than any other regulators. [score:5]
Stable over -expression of miR-25 also suppressed the growth of colon cancer-cell xenografts in vivo [57]. [score:5]
Functional studies revealed that restoration of miR-25 expression inhibited cell proliferation and migration. [score:5]
Among 5 significant components, hsa-miR-25, AXIN1, ATF6 and BRCA1 exhibited a negative correlation between their expression levels and patients’ survival, while higher expression of ADAMTSL3 was observed in patients with a better survival. [score:5]
In contrast, miR-25 inhibition could promote the proliferation and migratory ability of cells. [score:3]
In Li’s study, miR-25 was found to be down-regulated in human colon cancer tissues when compared to those in matched non-neoplastic mucosa tissues [56]. [score:3]
For instance, low expression of hsa-miR-25 was observed with the increasing all-caused death risk for CRC patients. [score:3]
Among above three subnetworks, 15 genes (FZD3, KCNA4, RAD21, KIAA1109, LYST, SCN11A, AKAP6, PCDHA13, ADAMTSL3, PCDH11X, MAP2K4, COL11A1, FBN1, NAV3 and FN1), 7 miRNAs (hsa-miR-25, hsa-miR-29a, hsa-miR-34a, hsa-let-7c, hsa-let-7e, hsa-miR-27b, hsa-miR-27a) and 8 TFs (FOXG1, TCF12, FOXJ2, MYCN, TFEB, CREB1, RUNX1, CBFB) participated in all subnetworks simultaneously, which suggested that they might act extensively in the CRC regulation. [score:2]
Interestingly, we noticed that hsa-miR-25 had the highest degree value in both of the composite-SNW and miRNA-SNW, suggesting that hsa-miR-25 might be a critical molecule in the regulatory process of CRC. [score:2]
Accordingly, two hub miRNAs (hsa-miR-25 and hsa-miR-31), two hub genes (ADAMTSL3 and AXIN1) and one hub TF (BRCA1) were identified. [score:1]
Finally, one composite-FFL (hsa-miR-25, HAND1, ADAMTSL3), one miRNA-FFL (hsa-miR-25, EGR2, ADAMTSL3) and 56 TF-FFLs were identified. [score:1]
Furthermore, as hsa-miR-25 and ADAMTSL3 had been proved playing important roles in CRC, but their exact interaction mechanism have not been clarified yet. [score:1]
We then applied the hub identification to the concise network to determine significant components, whereby two miRNAs (hsa-miR-25 and hsa-miR-31), two genes (ADAMTSL3 and AXIN1) and one TF (BRCA1) were identified significantly. [score:1]
Shapes and colors definitions for nodes and edges are the same as in the Fig. 2 As analyzed above, through our consecutive network framework, 5 components were identified, including two hub miRNAs (hsa-miR-25 and hsa-miR-31), two hub genes (ADAMTSL3 and AXIN1) and one hub TF (BRCA1). [score:1]
We then applied a hub identification strategy to the significant FFLs and found 5 significant components, including two miRNAs (hsa-miR-25 and hsa-miR-31), two genes (ADAMTSL3 and AXIN1) and one TF (BRCA1). [score:1]
The gene that had the largest degree was MASP1; and the miRNA and TF having the largest degrees were hsa-miR-25, hsa-miR-29b and HAND1 respectively (Fig. 2 and Additional file 2: Table S5). [score:1]
We found that some components participated in three types of subnetworks simultaneously, including 15 genes (FZD3, KCNA4, RAD21, KIAA1109, LYST, SCN11A, AKAP6, PCDHA13, ADAMTSL3, PCDH11X, MAP2K4, COL11A1, FBN1, NAV3 and FN1), 7 miRNAs (hsa-miR-25, hsa-miR-29a, hsa-miR-34a, hsa-let-7c, hsa-let-7e, hsa-miR-27b, hsa-miR-27a) and 8 TFs (FOXG1, TCF12, FOXJ2, MYCN, TFEB, CREB1, RUNX1, CBFB). [score:1]
There was only one miRNA hsa-miR-25 had a high degree value (the degree value was 7) (Fig. 2 and Additional file 2: Table S5). [score:1]
[1 to 20 of 19 sentences]
12
[+] score: 48
Gong et al [63] showed that miRNA-25 was overexpressed in primary tumor tissues of GC patients and promoted GC progression by directly downregulating Fbxw7 expression. [score:9]
Li et al [39] discovered that mutation led to increased expression of miR-25 and downregulation of Fbxw7, resulting in elevated levels of Aurora-A, which is critically important for the rapid proliferation and aggressive behavior of prostatic small cell neuroendocrine carcinoma. [score:7]
Xiang et al [62] found that miRNA-25 was significantly upregulated in nonsmall cell lung cancer (NSCLC) and promoted NSCLC cells proliferation and motility partially by targeting Fbxw7. [score:6]
Xiang J Hang JB Che JM miR-25 is up-regulated in non-small cell lung cancer and promotes cell proliferation and motility by targeting FBXW7. [score:6]
Li Z Sun Y Chen X Mutation Directs AURKA Overexpression via miR-25 and FBXW7 in prostatic small cell neuroendocrine carcinoma. [score:5]
What is more, several proteins such as, RITA, EBP2, Numb4, SGK1,,, Pin1, FAM83D, C/EBPδ, Hes-5, presenilin, miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a are found to regulate the expression of Fbxw7. [score:4]
Lu et al [61] demonstrated that miRNA-25 had important roles in reprogramming mouse fibroblast cells to induced pluripotent stem cells by regulating some candidate gene targets including Fbxw7. [score:4]
Gong J Cui Z Li L MicroRNA-25 promotes gastric cancer proliferation, invasion, and migration by directly targeting F-box and WD-40 Domain Protein 7, FBXW7. [score:3]
Besides those, recently, accumulating evidence has shown that several molecules such as, miRNAs including miR-223, miR-25, miR-27a, miR-182, miR-503, and miR-129-5p, RITA, and FAM83D, as well as Pin1, CCAAT/enhancer -binding protein-δ, presenilin,,, EBP2, Numb4 and serum-and glucocorticoid-inducible protein kinase1 could regulate Fbxw7 (Figure 3). [score:2]
Lu D Davis MP Abreu-Goodger C MiR-25 regulates Wwp2 and Fbxw7 and promotes reprogramming of mouse fibroblast cells to iPSCs. [score:1]
MicroRNAs (miRNAs) Including miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a. [score:1]
[1 to 20 of 11 sentences]
13
[+] score: 42
In detail, the expression of miR-186, miR-215 and miR-223 resulted upregulated in ATRA differentiated cells, while the expression of miR-17-5p, miR-25, miR-193, miR-195, and let-7a resulted downregulated (the miRNAs bolded were already reported as deregulated by ATRA in differentiated NB4 cells in refs. [score:12]
The densitometric analysis, carried out on three independent experiments, showed that in ATRA treated NB4 cells the expression of miR-17 decreased about 6 fold while the expression of miR-25 decreased about 4 fold. [score:5]
miR-17-5p and miR-25 are downregulated in NB4 cells differentiated upon ATRA treatment. [score:4]
The microarray data indicated a strong downregulation of miR-17 and miR-25 in the differentiated phenotype (Figure 1B and 1C, NB4 lanes UT vs. [score:4]
Hsa = human miRNAs; mmu = miRNAs E2F1 and E2F4 proteins level don't correlate with the miR-25 and miR-17 expression in NB4+ ATRA treated cells. [score:3]
Figure 1 Cluster analysis of treated and untreated NB4 cell lines using the 8 human miRNAs differentially expressed and Northern blot validation of miR-223, miR-17 and miR-25. [score:3]
These results would suggest that miR-17-5-p and miR-25 do not target E2F transcription factors, in NB4 cells from Acute Promyelocytic Leukemia. [score:3]
By in silico analysis we found that both miR-25 and miR-17 could have as putative targets E2F1 and E2F4, thus, they could synergistically act in the control of promyelocytic proliferation and differentiation. [score:3]
Hsa = human miRNAs; mmu = miRNAs Click here for file E2F1 and E2F4 proteins level don't correlate with the miR-25 and miR-17 expression in NB4+ ATRA treated cells. [score:3]
The membranes were probed as indicated on the side: B) miR- 17 probe and U6 snRNA probe; C) miR-25 probe and U6 snRNA probe; D) miR- 223 probe and U6 snRNA probe. [score:1]
For this reasons, further studies on the identification of genes possessing miR-17-5p or miR-25 complementary sequences are required. [score:1]
[1 to 20 of 11 sentences]
14
[+] score: 39
Other studies found that overexpression of miR-25 promoted cell proliferation (Zhang et al., 2012), while its downregulation stimulated apoptosis (Zhang et al., 2012) and oxidative stress (Varga et al., 2013). [score:6]
Lu et al. (2012) reported that miR-25 expression was found to affect the regulation of genes Wwp2 and Fbxw7, involved in regulating reprogramming of a cell to promote iPSCs, as these genes act to degrade the Yamanaka factors Oct4 and Klf5, respectively. [score:5]
SOF media +BSA Control SOF media +BSA SOF media −BSA Control SOF media −BSA miR-25 B/D – B/D – miR-302c – – – – miR-196a2 D + – – miR-181a B/D + N/A + miR-370 B/D + B/D + B, blastocyst media; D, degenerate media; –, not expressed; +, expressed. [score:5]
Although both miR-25 and miR-302c were expressed within bovine embryos, only miR-25 could be detected in the IVF culture media and the expression of these miRNAs was further observed in single and pooled human derived embryo media. [score:5]
MiR-25 was chosen as it is dynamically expressed within bovine embryos where expression increases from the 16-cell to the blastocyst stage (Tesfaye et al., 2009). [score:4]
MiR-25 regulates apoptosis by targeting Bim in human ovarian cancer. [score:3]
Table 3 shows that miR-25 was detected in media derived from bovine blastocysts and degenerates whereas miR-302c was not expressed in the culture media of these two embryo pools. [score:3]
MicroRNA-25 -dependent up-regulation of NADPH oxidase 4 (NOX4) mediates hypercholesterolemia -induced oxidative/nitrative stress and subsequent dysfunction in the heart. [score:3]
MiRNAs miR-181a2 (P < 0.0001), miR-196a2 (P < 0.0001), miR-302c (P < 0.0001), and miR-25 (P = 0.002) showed higher expression in degenerate embryos compared to blastocyst embryos (Figure 2). [score:2]
MiR-25 regulates Wwp2 and Fbxw7 and promotes reprogramming of mouse fibroblast cells to iPSCs. [score:1]
Both miR-25 and miR-302c were not detected in control SOF media regardless of supplementation with BSA (Table 3). [score:1]
Recently, miR-25 has been shown to mediate several processes such as oxidative stress in primary cardiomyctes (Varga et al., 2013), apoptosis in human ovarian cancer (Zhang et al., 2012) and cell reprogramming (Lu et al., 2012). [score:1]
[1 to 20 of 12 sentences]
15
[+] score: 37
Hence, miR-210 when inhibited increases the level of apoptosis in HeLa cells [46]; miR-22 promotes cell survival in UV irradiated cells through a tumor suppressor gene down-regulation [74]; down-regulation of miR-25 in ovarian cancer cells induces apoptosis [75]; miR-155 was described as having anti-apoptotic effects in murine macrophages during Helicobacter pylori infection [76]; and miR-133b is known to inhibit pro-survival molecules MCL-1 and Bcl-w proteins, two members of the BCL-2 family [47]. [score:13]
In order to check if the mRNA expression of these chemokines was negatively correlated with the up-regulation of all the corresponding targeting miRNAs (i. e., let-7a, miR-25, miR-23b, miR-26a, miR-132, miR-140, miR-146a, miR-146b, miR-155 and miR-210) identified in Table S2, we measured their levels using qRT-PCR. [score:6]
Figure 3 shows the relative expression levels of let-7a, miR-25, miR-26a, miR-132, miR-140, miR-146a and miR-155 at 3 and 6 h (panel A), and of five chemokines of their predicted targets at 12 and 24 h (panel B). [score:5]
Based on the observation that five chemokines (CCL2, CCL5, CXCL10, CXCL11 and CXCL12) are targeted by L. major-regulated miRNAs i. e., Let-7a, miR-25, miR-26a, miR-132, miR-140, miR-146a and miR-155, we show a negative correlation of transcript abundance with their corresponding miRNAs. [score:4]
0002478.g003 Figure 3Expression means of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3; panel A) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA mean levels at 12 and 24 h post-infection (panel B) in L. major-infected human macrophages. [score:3]
Expression means of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3; panel A) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA mean levels at 12 and 24 h post-infection (panel B) in L. major-infected human macrophages. [score:3]
Expression of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA levels at 12 and 24 h post-infection in L. major-infected human macrophages. [score:3]
[1 to 20 of 7 sentences]
16
[+] score: 36
Fluorescence in situ hybridization (FISH) was conducted in an area containing at least 85% tumor in order to appropriately visualize the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b in FFPE tissues of GC patients (Fig. 4b), and these experiments provided consistent results concerning the miRNA levels that the five miRNAs were up-regulated in GC patients. [score:6]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b The putative target genes of the miRNAs were identified by miRanda, miRDB, miRWalk, RNA22, and Targetscan. [score:5]
In the training and testing phases of our experiment, miR-185, miR-20a, miR-210, miR-25 and miR-92b were found to be significantly up-regulated in GC. [score:4]
MiR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in GC tissues by qRT-PCR (a: 30 pairs of tumor and matched normal tissues) and FISH (b: pictures were selected from 10 pairs of GC tissues and matched normal tissues). [score:4]
As shown in Fig. 4a, the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b was significantly higher in tumor than in normal tissues, and this correlation was consistent with results obtained from peripheral plasma. [score:3]
When the results of two stages were combined, miR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in peripheral plasma of GC patients compared with NCs (Fig. 2). [score:3]
None of the five miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) from GC patients demonstrated a significantly different expression level in peripheral plasma exosomes as compared to controls (Supplementary Table S6 online). [score:2]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b. [score:1]
Elevated plasma miR-25 was identified as a diagnostic and monitoring biomarker in esophageal squamous cell carcinoma 42. [score:1]
The relatively stable concentration of miR-25 (shown in Supplementary Table S5 online) in the arterial and peripheral venous plasma could reflect a relative balance of absorption and secretion of this particular miRNA in the circulation. [score:1]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b; N: normal controls; T: tumor. [score:1]
As for miR-25 and miR-92b, Zhu et al. 10 revealed that plasma miR-25 might be a potential biomarker in the detection of GC through relative quantification. [score:1]
The areas under the curve (AUC) were 0.65 (95% confidence interval (CI): 0.57–0.72), 0.67 (95% CI: 0.61–0.74), 0.75 (95% CI: 0.68–0.82), 0.65 (95% CI: 0.58–0.73) and 0.69 (95% CI: 0.62–0.76) for miR-185, miR-20a, miR-210, miR-25 and miR-92b, respectively (Supplementary Figure S1 online). [score:1]
Their results showed that the four miRNAs in our study (miR-25, miR-20a, miR-185 and miR-210) were co-purified with the Ago2 ribonucleoprotein complex other than exosomes in plasma while the form of miR-92b was undefined in the circulation. [score:1]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b. [score:1]
In the larger cohort, 5 of 11 miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) were consistent with those in the training stage (Table 2; the other miRNAs were shown in the Supplementary Table S2 and Table S3 online). [score:1]
[1 to 20 of 16 sentences]
17
[+] score: 34
Other miRNAs from this paper: mmu-mir-25
This result strongly suggests that the strong up-regulation of miR-25 expression might be responsible for the down-regulation of TOB1 expression in cancer cells. [score:11]
A recent study reported that miR-25, which is highly expressed in the plasma and primary tumor tissues from patients with gastric cancer, repressed TOB1 mRNA expression through direct interaction with its 3′-untranslated region (3′-UTR), thereby increasing the proliferation, metastasis, and invasion of gastric cancer cells [27]. [score:8]
miR25 represses TOB1 mRNA expression by binding to its 3′-untranslated region (3′-UTR) directly. [score:6]
Interestingly, we found that the miR-25 locus was highly amplified in these TCGA human clinical cancer samples and miR-25 expression was highly up-regulated in TCGA stomach cancer samples, showing its gain and amplification at the genomic level (Figure 3E–G). [score:6]
Figure 3Genomic copy number alteration and expression of AURKA, SAMD4, and miR-25 in TCGA human clinical cancer samples across a variety of cancer types. [score:3]
[1 to 20 of 5 sentences]
18
[+] score: 33
miR-144 and −101 downregulate ATXN1 expression, miR-25 does not affect ATXN1 levels Overexpression of miRNA duplexes and miRNA inhibitors followed by western blotting. [score:10]
Additionally, miR-29a and miR-34b showed the most dramatic changes in their expression levels, whereas the expression of miR-25 and mir-125b was associated with the course of disease. [score:7]
- Illumina Hi-Seq 2000, small RNAs from fly heads Drosophila mo dels: UAS-Atxn3-70Q and UAS-Atxn3-19Q[56] miR-34b is upregulated, and miR-25, −125b, −29a are downregulated in SCA3 patients. [score:7]
Expression of miR-25 and -125b was associated with the course of disease. [score:5]
The microarray analysis validated by qRT-PCR revealed that miR-25, miR-125b, miR-29a and miR-34b were differentially expressed in SCA3 patients. [score:3]
Of the three miRNAs tested, miRs 144 and 101 considerably decreased the endogenous ATXN1 protein levels (miR-25 activity was not observed). [score:1]
[1 to 20 of 6 sentences]
19
[+] score: 32
MDM2 mRNA is upregulated in both GBM cell lines and samples [65], and the upregulation could be a consequence of the downregulation of miR-17-3p, miR-181b-5p, miR-25-3p or miR-32-5p, which directly target MDM2 gene expression [50, 65, 66]. [score:15]
The feedback circuit can explain the overexpression of miR-25-3p in GBM reported by several separate studies, in which the miRNA is meant to be downregulated to increase MDM2 expression and thus inactivate TP53 [23, 47, 67]. [score:8]
Meanwhile, a systemic screen for miRNA aberrations by microarray of 245 miRNAs in GBM samples first identified a set of dysregulated miRNAs, including the upregulation of miR-10b-5p, miR-21-5p and miR-25-3p, and downregulation of miR-128-3p and miR-181a-5p/181b-5p/181c-5p [23]. [score:8]
It is worth noting that miR-25-3p and miR-32-5p are two miRNAs repressed by TP53, suggesting a feedback circuit between TP53 and MDM2 mediated by miRNAs [65]. [score:1]
[1 to 20 of 4 sentences]
20
[+] score: 32
Finally, we compared the expression levels of seven ZEB1- and four TP53 -targeting miRNAs in naïve and GC B cells (Figure 5B): all ZEB1 -targeting miRNAs were expressed at higher level in naïve compared to GC B cells; while only three (miR-221, miR-21 and miR-25) out of four TP53- targeting miRNAs (except miR-150) were upregulated in GC B cells. [score:12]
The four studies considered for the comparison, including the present study, demonstrated the higher expression in naïve B-cells of mir-320, the up-regulation of mir-181b, mir-25, miR-130b in GC B cells as well as the greater expression of both mir-29a and seven members linked to the cluster miR-17/92 in mature B cells. [score:7]
In particular, we identified two selective miRNA lists: the first one, composed by miR-150, miR-130b, miR-141, miR-29b, miR-26a, miR-34a and miR-200c, able to target the ZEB1 gene; and the second one, composed by miR-150, miR-221, miR-21 and miR-25, able to target the TP53 gene. [score:5]
An increased level of TP53 -targeting miRNAs in GC B cells such as miR-21, miR-25 and miR-200c could promote an additional control level of TP53 expression after the activation of the DNA damage response. [score:5]
MiRNAs belonging to the cluster mir-17/92 and the paralogous clusters mir-25/106b and mir-106a/363 showed a similar trend of expression, i. e. mir-17-5p, mir-20a, mir-106a, mir-20b, mir-18a, mir-106a, mir-18b, mir-20b, mir-106b, mir-93 and mir-25 (Cluster 1, Figure 1). [score:3]
[1 to 20 of 5 sentences]
21
[+] score: 30
A) K562 miRNA Host Transcript miRNA:Host transcript Status miR-342 EVL Downregulated miR-548e SHOC2 Downregulated miR-486 ANK1 Upregulated B) HL60 miRNA Host Transcript miRNA:Host transcript Status miR-22 C17orf91 Downregulated miR-151 PTK2 Downregulated miR-199b DNM1 Upregulated miR-25 MCM7 Upregulated miR-618 LIN7A Upregulated The analysis of microarray data revealed induction in the expression of some of the miRNA biogenesis genes (RNASEN, DGCR8, XPO5, RAN) in K562 cell line (Table 3). [score:27]
For example, miR-25 showed highest expression though it was farthest from the start site in miR-106b cluster (Figure 5). [score:3]
[1 to 20 of 2 sentences]
22
[+] score: 29
In addition, the main goal in the Italian study was to examine the prognostic impact of the serum expression of miR-16 and miR-25 at diagnosis, together with cytogenetics by FISH and ISS, which were already well established as prognostic factors, and to compare the expression of these miRNAs in 32 paired samples of serum and bone marrow plasma cells. [score:5]
The ANOVA test showed significant differences between control, MGUS, diagnostic and CR samples in the expression levels of miR-16 (P < 0.001), miR-17 (P < 0.001), miR-19b (P < 0.001), miR-20a (P = 0.002), miR-660 (P < 0.001) and miR-25 (P < 0.001), with the highest levels of expression observed in samples from healthy controls. [score:5]
A non-significant trend towards a difference in miR-331 expression was observed, and there were no significant differences between expression levels of miR-16, miR-17, miR-20a, miR-25 or miR-660. [score:5]
Although miR-25 was underexpressed in patients with MM compared to MGUS patients and healthy controls, among patients with oligoclonal bands miR-25 expression was higher than in the other patients in CR without serum oligoclonal humoral response (P = 0.002). [score:4]
For example, downregulation of circulating miR-16 and miR-25 were related to poor prognosis in multiple myeloma [23]. [score:4]
In addition, the miR-17-92 cluster and paralogs, which includes miR-25, have been related to the regulation of osteoblast proliferation and differentiation [32] and to the promotion of hematopoietic cell expansion by augmenting HIF-1a in osteoblasts [33]. [score:2]
We also observed a trend towards lower miR-25 levels in diagnostic samples from patients with lytic bone lesions than in those without them (P = 0.07). [score:1]
Along these lines, in the present study, there was a trend towards lower levels of miR-25 in patients who had bone lesions at diagnosis. [score:1]
Recently, miR-16 and miR-25 have been proposed as independent prognostic markers in newly diagnosed MM [23]. [score:1]
Differential serum levels of miR-16, miR-17, miR19b, miR-20a, miR-25 and miR-660 in patients with multiple myeloma (MM) at diagnosis (Dx) and at complete remission (CR), in patients with monoclonal gammopathy of undetermined significance (MGUS), and in healthy controls (HC). [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 28
Furthermore, miR-25 has been found to be expressed in several malignant cell lines (ovarian cancer cell line and cholangiocarcinoma), where it is involved in regulation of apoptosis and cell proliferation by targeting proapoptotic proteins as Bim and Trail (TNF-related apoptosis inducing ligand) [17, 28]. [score:6]
Furthermore, the residual beta-cell function and glycaemic control after 3 months of clinical disease associate with miR-25 expression level present soon after diagnosis. [score:5]
Several of these miRNAs are involved in regulation of apoptosis (miR-181a, miR-24, miR-25, miR-210, and miR-26a) [15– 19] and beta-cell regulatory networks (miR-24, miR-148a, miR-200a, and miR-29a) [20]. [score:3]
By regression analysis adjusting for age, sex, and multiple testing we found 12 miRNAs (miR-152, miR-30a-5p, miR-181a, miR-24, miR-148a, miR-210, miR-27a, miR-29a, miR-26a, miR-27b, miR-25, and miR-200a) to be significantly differentially expressed between either both diabetes cohorts and the control group or just one of the diabetes cohorts and the controls (Table 1) (P < 0.05). [score:3]
A previous study in an experimental diabetic nephropathy mo del investigated the role of miRNAs in the regulation of NADPH expression during hyperglycaemia and found miR-25 was significantly reduced in kidney from these animals [18]. [score:2]
Several reports associate high serum miR-25 with breast cancer, non-small-cell lung carcinoma and hepatocellular carcinoma [8, 25– 27]. [score:1]
The association of miR-25 with improved glycaemic control and better residual beta-cell function may indicate that this miRNA could be an important biomarker that could be used during early and intensive management of newly diagnosed diabetes to improve blood glucose control and reduce microvascular complications. [score:1]
These findings should be confirmed in an independent study population; however, we are currently investigating the miR-25 levels in all patients from our study cohorts at different time points during disease progression. [score:1]
Interestingly we found an association between miR-25 and better glycaemic control and residual beta-cell function. [score:1]
In the Danish cohort miR-25 measured at 1 month after disease onset was negatively associated with the HbA1c level and positively associated with stimulated C-peptide levels 3 months after onset. [score:1]
There have been several studies linking the miR-25 to different pathological conditions especially in cancer. [score:1]
Our present findings of improved residual beta-cell function in patients with high level of miR-25 are in accordance with these results, suggesting a role of miR-25 on cell proliferation of the endocrine cells of the pancreas. [score:1]
miR-25 measured at 12 months after disease onset was not associated with stimulated C-peptide or HbA1c in the Hvidoere cohort (data not shown). [score:1]
This is also supported by the lack of association between miR-25 and the degree of autoimmunity (as assessed by presence of autoantibodies) in our study. [score:1]
[1 to 20 of 14 sentences]
24
[+] score: 27
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Among the miRNAs distinctively over-expressed in NASH-derived HCC, miR-221-3p and miR-222-3p, which exhibited a carcinogenesis stage -dependent increase in expression, and miR-25-3p, miR-93-5p, and miR-106b-5p, which are members of the oncogenic miR-106b∼25 cluster, are of special interest. [score:5]
Mechanistically, the over -expression of miR-25-3p, miR-93-5p, and miR-106b-5p in NASH-derived HCC may be attributed to an increased expression of the Mcm7 gene, which harbors the miR-106b∼25 cluster [16– 18]. [score:5]
We also demonstrated that over -expression of miR-25-3p, miR-93-5p, miR-106b-5p, miR-221-3p, and miR-222-3p was accompanied by the reduced protein levels of their targets, including E2F1, PTEN, and CDKN1A. [score:5]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
Among the differentially expressed miRNAs in NASH-derived HCC, three miRNAs, miR-106b, miR-93, and miR-25, are members of the oncogenic miR-106b∼25 intragenic cluster [15, 16]. [score:3]
To investigate the functional consequences of the miR-106b∼25 cluster over -expression with respect to the hepatocarcinogenic process, the levels of E2F1, PTEN, and CDKN1A proteins, experimentally confirmed targets of miR-106b, miR-93-5p, and miR-25, were evaluated. [score:1]
[1 to 20 of 7 sentences]
25
[+] score: 27
Other miRNAs from this paper: hsa-mir-21, hsa-mir-31, hsa-mir-93, hsa-mir-155, hsa-mir-106b
Over-expressed miR-106b, miR-93, and miR-25 inhibit the synthesis of p21 [CIP1] and Bim (TGF-β downstream effectors) and therefore prevent cell cycle inhibition and apoptosisMutations in TβRII that lead to insensivity of cell lines to TGF-β mediated growth inhibition have been previously described [194]. [score:10]
Over-expressed miR-106b, miR-93, and miR-25 inhibit the synthesis of p21 [CIP1] and Bim (TGF-β downstream effectors) and therefore prevent cell cycle inhibition and apoptosis Mutations in TβRII that lead to insensivity of cell lines to TGF-β mediated growth inhibition have been previously described [194]. [score:10]
The relationship between TGF-β resistance and up-regulated level of miR-106b-25 cluster (miR-106b, miR-93, and miR-25) has been recently elucidated [193]. [score:4]
Over -expression of miR-106b, miR-93 and miR-25 decreases response of gastric cancer cells to TGF-β since they interfere with synthesis of TGF-β downstream effectors that promote cell cycle arrest and apoptosis, such as p21 [CIP1] and BIM, respectively [193] (Figure 5). [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 25
Li et al. reported that miR-25 was significantly down-regulated in human colon cancer tissues, and identified Smad7 as its direct target. [score:7]
These results suggest that miR-25 functions as a tumor suppressor by targeting Smad7 in colon cancer, suggesting that miR-25 may serve as a potential therapeutic target for colon cancer therapy. [score:7]
[51] miR-25 Colon cancer Smad7 In a xenograft mo del study, stable overexpression of miR25 in colon cancer cells suppressed tumor growth. [score:5]
In a xenograft mo del study, stable overexpression of miR25 in colon cancer cells suppressed tumor growth [52]. [score:5]
miR-25 in colon cancer cells. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 24
Xiang J. Hang J. B. Che J. M. Li H. C. MiR-25 is up-regulated in non-small cell lung cancer and promotes cell proliferation and motility by targeting FBXW7Int. [score:5]
Focusing on the miRNAs able to target different genes at the same time, we evidenced that the genes are targeted by twelve following miRNAs: hsa-miR24-3p, hsa-miR-6778-5p, hsa-miR-6514-3p, hsa-miR-5010-5p, hsa-miR-23a-5p, hsa-miR-25-5p, hsa-miR-6792-5p, hsa-miR-6866-5p, hsa-miR-4728-5p, hsa-miR-6825-5p, hsa-miR-6803-3p, hsa-miR-6794-5p (Table 2 and Figure 4). [score:5]
Zoni E. van der Horst G. van de Merbel A. F. Chen L. Rane J. K. Pelger R. C. Collins A. T. Visakorpi T. Snaar-Jagalska B. E. Maitland N. J. miR-25 Modulates Invasiveness and Dissemination of Human Prostate Cancer Cells via Regulation of αv- and α6-Integrin ExpressionCancer Res. [score:4]
Ren C. Wang W. Han C. Chen H. Fu D. Wang D. Shen M. High expression of mir-25 predicting poor prognosis in gastric cancerTransl. [score:3]
Zhang H. Zuo Z. Lu X. Wang L. Wang H. Zhu Z. MiR-25 regulates apoptosis by targeting Bim in human ovarian cancerOncol. [score:3]
Chen H. Pan H. Qian Y. Zhou W. Liu X. MiR-25-3p promotes the proliferation of triple negative breast cancer by targeting BTG2Mol. [score:2]
In regard to hsa-miR-25-5p, it is involved in proliferation and invasion mechanisms in lung cancer [107], is associated with a poor survival in gastric cancer patients [108], regulates apoptosis in ovarian cancer [109], promotes cell proliferation in triple negative breast cancer [110] and reduces the cell invasion in prostate cancer [111]. [score:2]
[1 to 20 of 7 sentences]
28
[+] score: 22
The present systematic review identified one most consistently reported upregulated miRNA, miRNA-21, which was consistently reported to be differentially expressed in 10 studies followed by miR-25, miR-92, and miR-223 in eight studies. [score:6]
The up-regulation of miR-25 was significantly correlated with the status of lymph node metastasis and TNM (Tumor, Node, and Metastasis) stage and overexpression markedly promoted migration and invasion of esophageal squamous cell carcinoma 37. [score:6]
Previous miRNA expression analysis had shown high expression of miR-25 in colorectal carcinoma 38. miR-92a was implicated in human hepatocellular carcinoma development and miR-92a in human blood had the potential to be a noninvasive molecular marker for the diagnosis of human hepatocellular carcinoma 39. [score:6]
From our study after miR-21, the most consistently reported upregulated microRNAs in eight studies were miR-25, miR-92, and miR-223. [score:4]
[1 to 20 of 4 sentences]
29
[+] score: 22
Other miRNAs from this paper: hsa-mir-93, hsa-mir-106b
Proteins of the Cip/Kip family inhibit the transition from G1 to S, thereby regulating the cell cycle; therefore, they proposed that rTMS might increase the expression of miR-25 in order to repress its target gene p57, thereby, as mentioned above, promoting adult NSC proliferation and inhibiting cell-cycle arrest. [score:10]
As we previously illustrated, p57, which can be suppressed by mir-25, is a Cdk inhibitor (CKI) that binds to Cdks to modulate transitions between cell cycle phases. [score:5]
Moreover, the researchers also found that when miR-25 is inhibited, the proliferation of NSCs located in SVZ was also blocked. [score:3]
In summary, rTMS mainly activates the miR-25/p57 signaling pathway, which is responsible for the enhancement of adult NSC proliferation after focal cerebral ischemia. [score:1]
Taken together, miR-25 may have a more elaborate and complex role in the proliferation of NSCs after rTMS, despite the discrepancy between the two experiments. [score:1]
Guo et al. found that 10 Hz rTMS stimulation in a rat mo del of cerebral ischemia resulted in a remarkable enhancement of miR-25. [score:1]
However, further studies are required to determine how miR-25 is affected after rTMS in NSCs. [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 21
a T cells were transfected with let-7i, miR-19b, miR-25 or miR-92a and then cultured under stimulation with anti-CD3 and anti-CD28 mAbs for 72 h. The phenotype was determined by flow cytometry based on cytokine expression (IFN-γ, IL-17A) and transcription factor expression (Foxp3). [score:5]
Gandhi et al. previously described upregulation of miR-25 [40] and miR-92a [39] in the sera or plasma of patients with MS, although it is unclear whether these changes reflect the altered exosomal miRNA profiles. [score:4]
Subsequently, we selected four miRNAs, let-7i, miR-19b, miR-25 and miR-92a for further analysis, the expression of which showed most significant differences between MS-exosome and HC-exosome (Fig.   2b). [score:3]
Materials used for transfection in this study were as follows: MISSION Human miRNA Mimics of hsa-let-7i-5p, hsa-miR-19b-3p, hsa-miR-25-3p and hsa-miR-92a-3p, and MISSION miRNA Negative Control 2 (all from Sigma-Aldrich, MO, USA); mirVana microRNA inhibitor of hsa-let-7i-5p and a negative control (Thermo Fisher Scientific, MA, USA); Silencer Select validated siRNAs of TGFBR1 and IGF1R, and Silencer Select Negative Control No. [score:3]
Subsequent analysis of the expression of exosomal miRNAs has demonstrated that the miRNA expression profiles in MS-derived exosomes are characterised by overabundance of four miRNAs: let-7i, miR-19b, miR-25 and miR-92a (Fig.   2). [score:3]
Error bars represent the mean ± s. d. s. d. standard deviation, n. s. not significant, A. U. arbitrary unit, RT-qPCR reverse transcription quantitative polymerase chain reaction, PBS phosphate-buffered saline To evaluate the functionality of the miRNAs upregulated in MS-exosome, CD3 [+] T cells from healthy donors were transfected with let-7i, miR-19b, miR-25 or miR-92a, and cultured with anti-CD3 and anti-CD28 mAbs for 72 h. Subsequently, the frequencies of inflammatory and regulatory T cell populations were evaluated by flow cytometer. [score:1]
Error bars represent the mean ± s. d. s. d. standard deviation, n. s. not significant, A. U. arbitrary unit, RT-qPCR reverse transcription quantitative polymerase chain reaction, PBS phosphate-buffered saline Treg cells but not Th1 or Th17 cells are affected by let-7iTo evaluate the functionality of the miRNAs upregulated in MS-exosome, CD3 [+] T cells from healthy donors were transfected with let-7i, miR-19b, miR-25 or miR-92a, and cultured with anti-CD3 and anti-CD28 mAbs for 72 h. Subsequently, the frequencies of inflammatory and regulatory T cell populations were evaluated by flow cytometer. [score:1]
Since miR-25 and miR-92a belong to the same family of miRNAs [42], we speculated that miR-19b, miR-25 and miR-92a in exosomes may have some function distinct from that of let-7i in MS pathogenesis, although we have not experimentally addressed this possibility yet. [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 21
miR-25 is the most significantly upregulated miRNA in multiple myeloma, and its expression is inversely correlated with mRNA levels, suggesting that miR-21 upregulation could be responsible for inactivation in cancers without mutation [28]. [score:10]
Cluster 25∼106b also significantly down-regulated activity, and we noted that miR-25 has been verified to directly target [28]. [score:7]
We have verified that miR-25 directly targets the gene [28]. [score:4]
[1 to 20 of 3 sentences]
32
[+] score: 19
Because EZH2 is a target of miR-25 (Esposito et al., 2012), miR-26a (Sander et al., 2008), miR-30d (Esposito et al., 2012), miR-101 (Varambally et al., 2008), and (Derfoul et al., 2011), downregulation of miR-25, miR-26a, miR-30d, miR-101, and in human cancers are associated with EZH2 upregulation and malignant phenotypes. [score:9]
Down-regulation of the miR-25 and miR-30d contributes to the development of anaplastic thyroid carcinoma targeting the polycomb protein EZH2. [score:7]
Circulating levels of microRNA from children with newly diagnosed type 1 diabetes and healthy controls: evidence that miR-25 associates to residual β-cell function and glycaemic control during disease progression. [score:3]
[1 to 20 of 3 sentences]
33
[+] score: 19
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 18
miRNA-25 and miRNA-30d directly target the 3′-UTR of TP53 to down-regulate p53 protein levels and to reduce the expression of genes that are transcriptionally activated by p53 [37]. [score:9]
Further TP53 targeting miRNAs are miRNA-30d, miRNA-25, and miRNA-504 [37]. [score:3]
Notably, there was no significant difference in the levels of miRNA-148a, miRNA-21 and miRNA-25 between in vitro digested exosomes and their respective undigested controls [26]. [score:1]
+ 15,27,32,33,29,180 miRNA-25 + ? [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
However, it is of critical concern, that today’s milk contains and transfers oncogenic miRNAs involved in the cancerogenesis of PCa such as miRNA-21, miRNA-25, and miRNA-125b [180]. [score:1]
In addition, miRNA-25-3p has been observed in human and porcine milk exosomes [34, 39]. [score:1]
[1 to 20 of 8 sentences]
35
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
The selectivity of HDI -mediated silencing of AICDA/Aicda and PRDM1/Prdm1 was emphasized by unchanged expression of HoxC4 and Irf4 (important inducers/modulators of AICDA/Aicda), Rev1 and Ung (central elements for CSR/SHM), and Bcl6, Bach2, or Pax5 (repressors of PRDM1/Prdm1 expression), as well as unchanged expression of miR-19a/b, miR-20a, and miR-25, which are not known to regulate AICDA/Aicda or PRDM1/Prdm1. [score:8]
[1 to 20 of 2 sentences]
36
[+] score: 17
The results of this experiment demonstrate that miR-25 is perhaps the most potent inhibitor of SERCA2a and is upregulated both in patients with severe heart failure and during trans-aortic constriction (TAC) -induced heart failure in a mouse mo del. [score:6]
Overexpression of miR-25 in vivo using adeno -associated virus 9 (AAV9) is related to declines in both fractional shortening and left ventricular (LV) function, whereas the inhibition of miR-25 with antagomiR reduces fibrosis and hypertrophy and improves cardiac contractility via the restoration of SERCA2a. [score:5]
Therefore, a strategy designed to inhibit miR-25 may be a key to developing a potential treatment for heart failure. [score:3]
Recently, Wahlquist et al. reported that miR-25 leads to an impairment in Ca [2+] uptake and exacerbates heart failure by directly interacting with SERCA2a mRNA [60]. [score:2]
3.2.1. miR-25. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 17
from microarrays (Figure 3) and qRT-PCR (Figure 7) suggested that levels of expression of all members of the miR-106b-25 cluster (miR-106b, miR-25, and miR-93) were decreased in cells transfected with miR-20b mimic or with miR-363-5p mimic (Figures 7A,B). [score:3]
Results presented in Figure 9 show that the level of expression of the pri-miR-25 transcript was higher than that of the pri-miR-106b transcript. [score:3]
presented in Figure 9 show that the level of expression of the pri-miR-25 transcript was higher than that of the pri-miR-106b transcript. [score:3]
Using the level of expression of the pri-miR-17 (5′-end) transcript as reference, that of pri-miR-92a-1(3′-end) was 4.6 ± 0.7 fold higher and those of pri-miR-106b (5′-end) and pri-miR-25 (3′-end) were 8.4 ± 2.0 - and 52.1 ± 4.1-fold higher, respectively. [score:3]
Results from microarrays (Figure 3) and qRT-PCR (Figure 7) suggested that levels of expression of all members of the miR-106b-25 cluster (miR-106b, miR-25, and miR-93) were decreased in cells transfected with miR-20b mimic or with miR-363-5p mimic (Figures 7A,B). [score:3]
The miR-106b-25 cluster, located on human chromosome 7, encodes three miRNAs: miR-106b, miR-93, and miR-25. [score:1]
The levels of expression of hsa-pri-miR-17, hsa-pri-miR-92a-1, hsa-pri-miR-106b, hsa-pri-miR-25, hsa-pri-miR-106a, and hsa-pri-miR-92a-2 were measured in E10 cells after transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
There was a positive correlation between miR-155 expression and white blood cell (WBC) count, serum lactate dehydrogenase (LDH), C-reaction protein (CRP) value in peripheral blood (PB), and miR-25 and miR-196b expression in AML [122]. [score:5]
Ectopic expression of miR-25 resulted in inhibition of migration in high motility cells [119]. [score:5]
The reason why these miRNAs are associated with a favorable prognosis is unclear, although miR-25 is reported to be involved in cell migration and dissemination by targeting αv- and α6-integrin. [score:3]
In addition, increased expression of miR-212, miR-25 and/or miR-203 has been associated with a favorable overall survival, event-free and relapse-free survival in AML patients independent of cytogenetic subtypes [65, 116– 118]. [score:3]
miR-25, integrin and cancer invasiveness. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 17
A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overlap in their predicted target genes; B) miR-25 and miR-183, two miRNAs with a single nucleotide difference within their respective seed regions have only 18% overlap in their predicted target genes; C) The overlap of predicted targets for all 249 pairs of conserved miRNAs grouped by the number of mismatches in their respective seed regions. [score:7]
0115241.g001 Figure 1 A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overlap in their predicted target genes; B) miR-25 and miR-183, two miRNAs with a single nucleotide difference within their respective seed regions have only 18% overlap in their predicted target genes; C) The overlap of predicted targets for all 249 pairs of conserved miRNAs grouped by the number of mismatches in their respective seed regions. [score:7]
For example, the percent target gene overlap for miR-25 and miR-32 (both having the seed sequence: 5′AUUGCAC) predicted by miRanda-mirSVR is 81% (Fig. 1A). [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 16
For instance, miR-25 has been shown to be downregulated in colon cancer tissues, as compared with normal mucosal tissues (35), and has demonstrated the ability to inhibit colon cancer cell growth and migration through downregulation of a target gene, Smad7, which is involved in the proliferation and metastasis of colon cancer (35). [score:10]
However, miR-25 has also been reported to be upregulated in esophageal squamous cell carcinoma (ESCC) tissues, and miR-25 overexpression was observed to induce ESCC cell metastasis and invasion via binding to the 3′UTR of epithelial cadherin (36). [score:6]
[1 to 20 of 2 sentences]
41
[+] score: 15
Moreover, microRNA-25 has an antiapoptotic role in human gastric adenocarcinoma cells, possibly via inhibition of FBXW7, thus promoting the expression of oncogenes such as CCNE1 and MYC [35]. [score:5]
The results predicted that microRNA-24, microRNA-106a, microRNA-19b and microRNA-25 may be closely related to apoptosis; n = 3. Table 1 Predicted target genes analysis of microRNAs expressed in huMSC-EXOs. [score:5]
Zhang, Y., Peng, Z., Zhao, Y. & Chen, L. microRNA-25 Inhibits Cell Apoptosis of Human Gastric Adenocarcinoma Cell Line AGS via Regulating CCNE1 and MYC. [score:4]
We predicted that microRNA-24, microRNA-106a, microRNA-19b and microRNA-25 may be closely related to apoptosis. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 15
Six of these miRNAs miR-16, miR-302d-3p, miR-378e, miR-570–3p, miR-574-5p, miR-579; were down-regulated and one was up-regulated miR-25-3p in T1DM plasma-derived exosome samples compared to the control (p value < 0.05) (Figs  2B and 3). [score:6]
We identified and confirmed that of the seven miRNAs whose levels change in plasma exosomes from T1DM subjects, 6 which were lower in T1DM patients (miR-16, miR-302d-3p, miR-378e, miR-570-3p, miR-574-5p, and miR-579) and 1 upregulated (miR-25-3p) several appear to play important roles in diabetes. [score:4]
miRNA miRBase ID sequence hsa-miR-16-5p MIMAT0000069 uagcagcacguaaauauuggcg hsa-miR-25-3p MIMAT0000081 cauugcacuugucucggucuga hsa-miR-302d-3p MIMAT0000718 uaagugcuuccauguuugagugu hsa-miR-378e MIMAT0018927 acuggacuuggagucagga hsa-miR-570-3p MIMAT0003235 cgaaaacagcaauuaccuuugc hsa -miRNA- 574-5p MIMAT0004795 ugagugugugugugugagugugu hsa -miRNA-579 MIMAT0003244 uucauuugguauaaaccgcgauu hsa -miRNA- 631 MIMAT0003300 agaccuggcccagaccucagc hsa -miRNA-let-7 MIMAT0000062 ugagguaguagguuguauaguu hsa-RNU6-2 — acgcaaattcgtgaagcgtt Because of the absence of a validated reference genes in the plasma exosome samples for the normalization of exosome microRNA expression data, it was critical to choose an appropriate housekeeping microRNA. [score:3]
To validate the RNA sequencing data, we performed a qRT-PCR analysis of hsa-let-7, hsa-miR-631, RNU6, hsa-miR-16-5p, hsa-miR-25-3p, hsa-miR-302d-3p, hsa-miR-378e, hsa-miR-570-3p, hsa-miR-574-5p, and hsa-miR-579. [score:1]
For example, the level of hsa-miR-25-3p was reported to be significantly increased in the serum of new onset T1DM subjects, where it may have a role in glycemic control 22, 23. [score:1]
[1 to 20 of 5 sentences]
43
[+] score: 15
For the first set of MSCs only 3 miRNAs (miR-324-3p, miR-494-3p, and miR-1260a) were observed to be statistically significant (p < 0.05) between passages 3 and 7. For the second set of MSCs, 7 miRNAs (let-7i, miR-25-3p, miR-106b-5p, miR-130b-3p, miR-199a-5p, miR-365a-5p, and miR-1260a) were statistically significant between passages 4 and 8. MiR-1260a was found to be significantly different between early and late passages for both MSC sets; however, it was upregulated at passage 7 for the first MSC set and downregulated at passage 8 for the second MSC set. [score:7]
For the tested miRNAs not expressed from the microarray experiments, 2 miRNAs, miR-25-3p and miR-130b-3p, were observed to be expressed based on the studies while 1 miRNA, miR-106b-5p, was not. [score:5]
In evaluating early passage MSCs (13 cell lines) against the 4 cell lines of the mesoderm lineage, 5 miRNAs (miR-15b-5p, miR-25-3p, miR-320d, miR-324-3p, and miR-494-3p) were observed to be significantly upregulated (p < 0.05) in the non-MSC lines. [score:2]
Another 3 miRNAs (miR-25-3p, miR-106b-5p, and miR-130b-3p) were not expressed in all MSC samples using the microarray platform and were evaluated by to confirm our results. [score:1]
[1 to 20 of 4 sentences]
44
[+] score: 14
Our data agree with their observation of downregulation of miR-34a-5p by E6 and upregulation of miR-25-5p by E7, as well as the finding that modulation of the expression of some miRs can be attributed to one or both oncoproteins. [score:9]
The miR-106b~25 cluster is known to be regulated by E2F family members (49), and a member of that cluster, miR-25-5p, is one of the top miRs upregulated by HPV16 E7. [score:5]
[1 to 20 of 2 sentences]
45
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In spent media, miR-25, miR-302c, miR-196a2, and miR-181a expression were found to be higher in arrested embryos than in blastocysts [77], as can be seen in Figure 4. The spent culture media from 55 single-embryo transfer cycles were tested for miRNA expression using an array -based quantitative real-time polymerase chain reaction analysis and the expression of the identified miRNA was correlated with pregnancy outcomes in these cycles [78]. [score:7]
In spent media, miR-25, miR-302c, miR-196a2, and miR-181a expression were found to be higher in arrested embryos than in blastocysts [77], as can be seen in Figure 4. The spent culture media from 55 single-embryo transfer cycles were tested for miRNA expression using an array -based quantitative real-time polymerase chain reaction analysis and the expression of the identified miRNA was correlated with pregnancy outcomes in these cycles [78]. [score:7]
[1 to 20 of 2 sentences]
46
[+] score: 14
In fact, growing evidence of indirect p53 deregulation in MM through MDM2 overexpression, TP53 promoter hypermethylation and alterations in certain miRNAs that directly or indirectly affect p53 expression, such as miR-25, miR-30d, miR-125a-5p and miR-214, have been reported. [score:9]
Two miRNAs, miR-25 and miR-30d, which directly interact with the 3′-UTR of the human TP53 mRNA [107] are downregulated in MM and their levels are inversely correlated to TP53 mRNA. [score:5]
[1 to 20 of 2 sentences]
47
[+] score: 14
By combining the microarray expression data with results of the prediction software TargetScan, three up-regulated miRNAs (miR-33a, miR-25 and miR-363) potentially able to regulate TWIST 3′-UTR were selected and individually tested for their ability to affect luciferase expression in MG-63 human OS cells co -transfected with the TWIST-3′UTR-luciferase reporter. [score:11]
Among the selected miRNAs, miR-33a, miR-25 and miR-363 were differentially expressed between chemoresistant and control osteosarcoma tissues based on results of the microarray analysis. [score:3]
[1 to 20 of 2 sentences]
48
[+] score: 14
For instance miR-17/92 cluster members were upregulated in hMSC (miR-106b-5p and miR-25-3p) but downregulated (miR-93-3p and miR-25-5p) in hESCs (Fig 3c). [score:7]
Taken together the hypoxic miRNA profiles of hESCs and hMSCs were largely distinct with only miR-25-3p (upregulated), mir-1275 and miR-23a-5p (both downregulated) overlapping between the two stem cell populations. [score:7]
[1 to 20 of 2 sentences]
49
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
In addition to miR-221/222, several studies also highlighted the differential regulation of let-7d, let-7f, miR-25 and miR-26b in prostate and breast cancer, as well as in leukemia by the estrogen receptor pathways and that their expression was up-regulated in ERα -positive cells [50- 52]. [score:7]
Among the fourteen miRNAs mapped to the ingenuity databases, twelve (rno-let-7d, rno-miR-132, rno-miR-182, rno-miR-183, rno-miR-184, rno-miR-21, rno-miR-221, rno-miR-24, rno-miR-25, rno-miR-26b, rno-miR-31 and rno-miR-96) had 171 experimentally validated targets. [score:3]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
[1 to 20 of 3 sentences]
50
[+] score: 13
miR-25 promotes GC progression by directly downregulating TOB1 expression; therefore, increased expression of miR-25 presents a potential noninvasive biomarker for the prognosis of GC patients [17]. [score:9]
Li BS, Zuo QF, Zhao YL, Xiao B, Zhuang Y, Mao XH, et al. MicroRNA-25 promotes gastric cancer migration, invasion and proliferation by directly targeting transducer of ERBB2, 1 and correlates with poor survival. [score:3]
In addition, we also found that some previously well proved molecules, such as miR-7 [18], miR-25 [17], TOB1 and IGF1R, were not be identified in our microarrays. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 13
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21
Our group has recently shown that MEK inhibition restores PTEN expression in tumor cells with an intact PTEN gene by inhibiting a re-wired MEK–ERK–c-Jun/miR-25 survival pathway. [score:7]
Our group has recently shown that miR-25 expression levels are controlled by ERK activation status, which in turn regulates PTEN protein levels in melanoma cells. [score:4]
As it has been discussed above for the involvement of c-Jun, miR-25 provides another interesting link between the MEK/ERK and PI3K/PTEN/AKT/mTOR pathways. [score:1]
Recently, it has been shown that miR-25 controls PTEN levels in human tumors and contributes to experimental tumorigenesis (106, 134). [score:1]
[1 to 20 of 4 sentences]
52
[+] score: 12
MiR-25 and miR-92a show a high expression correlation (PCC = 0.798), whereas miR-92b has distinct expression patterns with miR-25 and miR-92a. [score:5]
The expression correlation between miR-92a and miR-92b is 0.2, and the expression correlation between miR-25 and miR-92b is 0.172. [score:5]
For example, three miRNAs including miR-25, miR-92a and miR-92b are from the miR-25 family. [score:1]
Both miR-25 and miR-92a were found to play roles in cell proliferation [31], [47]. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 12
Our results are consistent with those of previous studies and demonstrated that miR-25, miR-17, miR-30d and miR-92a are overexpressed, and miR-221 is downregulated in prostate cancer (9, 42– 44). [score:6]
As demonstrated in Fig. 3A, the expression levels of radiation -induced miRNAs, miR-25, miR-30a and miR-550a, were significantly upregulated in the prostate cancer cells compared with the corresponding normal tissue cells. [score:5]
In the present study, we also identified radiation-response miRNAs that had been reported in other types of cancer but not in prostate cancer, such as miR-25, miR-15a, miR-30d, miR-125a, miR-221 and miR-342 (21, 56– 63). [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 12
Highest-ranking miRNAs included miR-16/15a (46 targets), miR-27b (44 targets), let-7f (35 targets), miR-26b (33 targets), and miR-25 (30 targets). [score:11]
These observations were validated by qRT-PCR on “positive” miRNAs (i. e., miR-16, miR-15a, and miR-25) (Fig. 4D) in an independent set of animals (n = 3 per group). [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 12
First, the expression patterns of several miRNAs (miRNA-221, miRNA-222, and miRNA-365) display mechanoresponsiveness [71, 72], while a mechanoregulatory protein, integrin alpha-5, the levels of which are correlated with BMI, was identified as a target of miRNA-25 that is down-regulated in OA specimens [70]. [score:9]
On the contrary, an inverse correlation for those miRNAs of which expression is negatively modulated in OA (miRNA-25, miRNA-29a, and miRNA-337) and BMI was observed [70]. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 12
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
For example, the expression levels (read counts) for hsa-mir-25-3p are 24,268 and 15,875 for hESCs and hEBs, respectively. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 12
In normal cells, let-7 -mediated suppression of c-Myc expression helps maintain basal low level expression of Aurora-A mRNA, while miR-25 -targeted Fbxw7α regulates basal level protein expression (41– 45). [score:12]
[1 to 20 of 1 sentences]
58
[+] score: 12
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 12
Based on microarray result from a previous study [15], butyrate also down-regulates expression of miR-221/222 and miR-25. [score:6]
Often, p57 is epigenetically silenced in cancer [45, 46], partially due to transcriptional regulation by histone deaceylation/methylation and translational regulation by miRNAs such as miR-221/222, miR-25, miR-92b and miR-92a (Fig.   9a) [16, 35, 47– 49]. [score:5]
For example, miR-25 levels decreased ~30 % after butyrate treatment, confirmed by qPCR (data not shown). [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 12
Other miRNAs from this paper: hsa-mir-21, hsa-mir-221, hsa-mir-92b
Recently, microRNAs (miR-221/222, miR-25, miR-92b) were reported to downregulate the expression of p57 [Kip2] transcript [13, 14]. [score:6]
miR-92b and miR-25 have also been reported to down-regulate p57 [Kip2] expression in human embryonic stem cells and in gastric cancer respectively [12, 13]. [score:6]
[1 to 20 of 2 sentences]
61
[+] score: 12
In tumors with high expression of this cluster, a reduced expression of Bim, a miR-25 target and a critical regulator of apoptosis that plays an essential role in mammalian development, is observed [42]. [score:9]
Recently, it has been observed that the mir-106b-25 cluster (which includes miR-106b, miR-93 and miR-25, and is located at FRA7F) is over-expressed in hepatocellular carcinoma [42], a malignant tumor which is often related to high alcohol consumption [43]. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 11
Additionally, 9 miRNAs (hsa-miR-484, hsa-miR-499-5p, hsa-miR-126*, hsa-miR-491-5p, hsa-miR-1303, hsa-miR-539, hsa-miR-25*, hsa-let-7e*, and hsa-miR-194*) were upregulated in 10 diseases while not downregulated in any other, as the balloon plot (Figure  3) of all miRNAs significant in at least 8 of 19 diseases (>40%) shows. [score:11]
[1 to 20 of 1 sentences]
63
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Kim et al. showed that over -expression of the miR-222-221 cluster also enhances the growth of GC xenografts in nude mice [27], further reporting that miR-25 targets p57. [score:5]
Gong J. Cui Z. Li L. Ma Q. Wang Q. Gao Y. Sun H. MicroRNA-25 promotes gastric cancer proliferation, invasion, and migration by directly targeting F-box and WD-40 Domain Protein 7, FBXW7 Tumour Biol. [score:3]
Of these, miR-17-5p, miR-18a, miR-20a, miR-200c, miR-21, miR-218, miR-221, miR-222, miR-25, miR-27a, miR-376c, and miR-744 were found to be significantly elevated in GC patients, and their expression was significantly reduced after surgery [26, 27, 54, 68, 71, 80, 81, 155, 187, 192, 193, 195, 196, 198, 199, 200, 201, 202, 203, 204, 205]. [score:3]
[1 to 20 of 3 sentences]
64
[+] score: 11
Other miRNAs from this paper: hsa-mir-21, hsa-mir-146a, hsa-mir-155, hsa-mir-146b
Instead, this study demonstrated down-regulation of multiple miRNAs and proceeded to show that reduced miR-25 expression increased the release of inflammatory mediators, extracellular matrix turnover and production of contractile proteins through up-regulation of Krüppel-like factor 4 (KLF4), a target of miR-25 [64]. [score:11]
[1 to 20 of 1 sentences]
65
[+] score: 11
CDK4, APPBP2, ZNF10, CDK13, and AKTIP are inhibited by let-7d, APPBP2 is inhibited by mir-200a, KLC1, FLNB, MYBL1, and GCN1L1 are inhibited by mir-223, FBXW7, ZNF274, and IRF8 are inhibited by mir-130a, and FUBP1 is inhibited by mir-25. [score:11]
[1 to 20 of 1 sentences]
66
[+] score: 11
The top ranked miRNAs (NPES > 2.8, p = 0.001 and FDR < 0.02) included, miR-19b-3p (miR-19ab family) and miR-92a/b-3p (miR-25/32/92abc/363/363-3p/367 family), were significantly upregulated in eBL tumor cells, and targets tumor suppressor genes such as ATM and NLK, which are observed to be downregulated in eBL. [score:11]
[1 to 20 of 1 sentences]
67
[+] score: 10
miR-93-5p, as a member of the microRNA gene cluster miR-106b~25 (miR-106b, miR-93, and miR-25), is expressed in primary stem cells [21] and normal tissue [22] as well as in pathological contexts, such as tumour development [23], ageing [24], bone formation [25], and cardiovascular disease [26]. [score:6]
These differences included 35 up-regulated miRNAs, such as miR-93-5p, miR-7i-5p, miR-320a, miR-25-3p, and miR-16-2-3p (fold > 2.0, P < 0.05). [score:4]
[1 to 20 of 2 sentences]
68
[+] score: 10
For example, a bioinformatics -based prediction indicates that hsa-miR-939 can target vascular endothelial growth factor A (VEGF A), inducible nitric oxide synthase 2A, and the alpha subunit of voltage-gated sodium channel type IV and that hsa-miR-25 can target endothelin receptor type B. Since one of the predicted gene targets for hsa-miR-939 is VEGF A, the upregulation of VEGF in the serum of CRPS patients strengthens the prediction. [score:10]
[1 to 20 of 1 sentences]
69
[+] score: 10
In our previous study on the young stroke patients with existing risk factors [15], we found only miR-25* to be expressed but it remained up-regulated. [score:6]
Among them, miR-25*, -34b, -483-5p and miR-498 were found to be down-regulated in all cases. [score:4]
[1 to 20 of 2 sentences]
70
[+] score: 10
Fu Y. Zhang Y. Wang Z. Wang L. Wei X. Zhang B. Wen Z. Fang H. Pang Q. Yi F. Regulation of nadph oxidase activity is associated with mirna-25 -mediated nox4 expression in experimental diabetic nephropathy Am. [score:4]
Induction of G1/S arrest via Wnt -inhibition on the level of β-catenin by miR-25 [25] could theoretically intensify phototoxicity following PDT (shown for rapamycin in vitro [72]). [score:3]
MiR-25 (which shows highest level of significance in correlation with PDT toxicity) targets AKT2, SESN3, BCL2, NOX4, HMOX2, and TRAF6. [score:2]
Espinosa-Parrilla Y. Munoz X. Bonet C. Garcia N. Vencesla A. Yiannakouris N. Naccarati A. Sieri S. Panico S. Huerta J. M. Genetic association of gastric cancer with mirna clusters including the cancer-related genes mir29, mir25, mir93 and mir106: Results from the epic-eurgast study Int. [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-33a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-141, mmu-mir-155, mmu-mir-10b, mmu-mir-129-1, mmu-mir-181a-2, mmu-mir-183, mmu-mir-184, hsa-mir-192, mmu-mir-200b, hsa-mir-129-1, mmu-mir-122, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-183, hsa-mir-210, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-129-2, hsa-mir-184, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-96, mmu-mir-34a, mmu-mir-129-2, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-25, mmu-mir-210, mmu-mir-181a-1, mmu-mir-216a, mmu-mir-223, mmu-mir-33, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-217, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-375, mmu-mir-375, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-33b, mmu-mir-216b, hsa-mir-216b, mmu-mir-1b, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-129b, mmu-mir-216c, bbe-let-7a-1, bbe-let-7a-2, bbe-mir-10a, bbe-mir-10b, bbe-mir-10c, bbe-mir-125a, bbe-mir-125b, bbe-mir-129a, bbe-mir-129b, bbe-mir-133, bbe-mir-1, bbe-mir-183, bbe-mir-184, bbe-mir-200a, bbe-mir-200b, bbe-mir-210, bbe-mir-216, bbe-mir-217, bbe-mir-22, bbe-mir-252a, bbe-mir-252b, bbe-mir-278, bbe-mir-281, bbe-mir-33-1, bbe-mir-33-2, bbe-mir-34a, bbe-mir-34b, bbe-mir-34c, bbe-mir-34d, bbe-mir-34f, bbe-mir-375, bbe-mir-7, bbe-mir-71, bbe-mir-9, bbe-mir-96, bbe-mir-34g, bbe-mir-34h, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The sequencing frequency of the four most abundantly expressed miRNAs (miR-22, miR-1, let-7a and miR-25) constituted 78.82% of the total miRNA sequencing reads, suggesting that they might be ubiquitously expressed in amphioxus. [score:5]
As shown in the figure, bbe-miR-1, bbe-let-7, bbe-miR-25, bbe-miR-22, and so on were clearly expressed in amphioxus. [score:3]
In contrast, many phylogenetically conserved miRNAs, as well as miRNAs present in both chordates and vertebrates (for example, miR-216, miR-217, miR-22, miR-25, and miR-96), could be reliably traced back to B. belcheri (Gray). [score:1]
Based on the available nematode, fruitfly, zebrafish, frog, chicken, mouse, rat and human miRNA information [18], 45 conserved amphioxus miRNAs could be classified into three distinct groups: 23 miRNAs (let-7a, miR-1, miR-7, miR-9, and so on) were conserved throughout the Bilateria; 5 miRNAs (miR-252a, miR-252b, miR-278, miR-281 and miR-71) were homologous to invertebrate miRNAs; and 17 miRNAs (miR-141, miR-200a, miR-200b, miR-183, miR-216, miR-217, miR-25, miR-22, miR-96, and so on) were present both in chordates and vertebrates (Table S9 in). [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
Kuhn A. R. Schlauch K. Lao R. Halayko A. J. Gerthoffer W. T. Singer C. A. MicroRNA expression in human airway smooth muscle cells: Role of miR-25 in regulation of airway smooth muscle phenotype Am. [score:4]
miR-25-3p targets KLF4, which is a potent mediator of inflammation [149], and has a crucial role in the development of the immune system [51]. [score:4]
These 12 microRNAs (let-7a-5p, miR-182-5p, miR-191-5p, miR-200c-3p, miR-21-5p, miR-25-3p, miR27b-3p, miR-30a-5p, miR-30c-2-5p & -1-5p, miR-30d-5p, miR-375-3p, and miR-574-3p) [51] are all immune-related and they regulate immune response genes and proteins [140]. [score:2]
[1 to 20 of 3 sentences]
73
[+] score: 10
miR-25, miR-93, miR-106b, and miR-130 inhibit apoptosis by preventing the expression of the pro-apoptotic protein, Bim (Figure 2) [14]. [score:5]
In addition, miR-25 targets p57, while miR-221 and miR-222 target p27 and p57 [15] (Figure 1). [score:5]
[1 to 20 of 2 sentences]
74
[+] score: 10
Among the miRNAs downregulated by resveratrol, miR-17, miR-21, miR-25, miR-92a-2, miR-103-1 and miR-103-2 have been shown to behave as onco-miRNAs, at least in certain contexts. [score:4]
Beside miR-21, several miRNAs are overexpressed in CRCs, including miR-17, miR-25, miR-26a, and miR-181a [54, 55]. [score:3]
MiR-17, miR-25, miR-26-a, and miR-181a are also overexpressed in CRCs [34, 54]. [score:3]
[1 to 20 of 3 sentences]
75
[+] score: 9
Other miRNAs from this paper: hsa-mir-93, hsa-mir-106b
The miR-106b-25 cluster (miR-106b, miR-93, and miR-25) is involved in E2F1 posttranscriptional regulation and Targets PTEN. [score:4]
miR-106b, miR-93 and miR-25 form a cluster, all expressed from the same intron. [score:3]
hsa-miR-25-star_st is known to regulate TP53 negatively. [score:2]
[1 to 20 of 3 sentences]
76
[+] score: 9
Bone morphogenetic protein receptor 2 (BMPR2) is known to be targeted by miR-19a, −20a and miR-25 [28] and predicted to be targeted by miR-455. [score:5]
These 10 miRNAs and their predicted regulatory network are presented in Fig.   5. Bone morphogenetic protein 2 (BMP2) and BMP7 are predicted to be targeted by miR-20a,-140 and miR-25, −30b, respectively. [score:4]
[1 to 20 of 2 sentences]
77
[+] score: 9
Other miRNAs from this paper: hsa-mir-106b
To determine whether the miR-25 -mediated downregulation of SOCS4 expression is a common feature in thyroid cancer cells, similar experiments were performed in WRO cells (Fig 3F and 3G). [score:6]
The miR–25 inhibitor (miR-25-Inh) significantly stimulated the luciferase activity of the WT SOCS4 3′-UTR, without any effect on Mut SOCS4 3′-UTR in K1 cells (Fig 3C). [score:3]
[1 to 20 of 2 sentences]
78
[+] score: 9
We suggest that some miRNAs targeting this machinery (e. g., let-7, miR-27, miR-29, and miR-103) are expressed fairly wi dely, while others (e. g., miR-138 and miR-25) have lower and more restricted expression. [score:7]
Our data suggest that the RNAi–miRNA machinery itself is under miRNA regulation; for example Dicer appears to be controlled by let-7 and miR-15b; Ago-1 by let-7 and miR-29b/c; Ago-2 by miR-138; Ago-3 by miR-138, miR-25, and miR-103; and Ago-4 by miR-27a/b. [score:2]
[1 to 20 of 2 sentences]
79
[+] score: 9
Li Z Sun Y Chen X Squires J Nowroozizadeh B Liang C p53 Mutation Directs AURKA Overexpression via miR-25 and FBXW7 in Prostatic Small Cell Neuroendocrine CarcinomaMol Cancer Res. [score:5]
MicroRNAs (miRNAs) including miR-27 [34], miR-25 [35] and miR-223 [36] have been reported to be involved in regulating the expression of FBXW7. [score:4]
[1 to 20 of 2 sentences]
80
[+] score: 9
In particular, the Hh -mediated DR4 downregulation relied on both the functional activation of Gli3, which directly repressed DR4 promoter function [169], and the transcriptional activation of miR-25, which inhibited the translation of DR4 mRNA [170]. [score:9]
[1 to 20 of 1 sentences]
81
[+] score: 9
hsa-miR-25 is differentially expressed in DLBCL, and forms an association between PTEN and TP53; PTEN may influence TP53 expression via hsa-miR-25. [score:5]
Poliseno et al (28) observed that PTEN regulates hsa-miR-25 and Kumar et al (29) indicated that TP53 is targeted by hsa-miR-25. [score:4]
[1 to 20 of 2 sentences]
82
[+] score: 8
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
[1 to 20 of 4 sentences]
83
[+] score: 8
Ranking genes in the myeloid cluster by their connectivity, we found ABL2, a gene which regulates cytoskeleton remo deling during cell differentiation, cell division and cell adhesion was found to be targeted by the largest number of miRNAs (N = 5: miR-223, miR-143, miR-25, miR-27, miR-17), followed by EIF4A2, EPC1 and INO80D, which were targeted by four miRNAs each. [score:6]
The final network consisted of two clusters, a large cluster consisting of 9 miRNAs specific to neutrophils, monocytes and myeloid lineage cells (miR-223, miR-143, miR-145, miR-25, miR-27, miR-425, miR-17, miR-652 and miR-191) and a much smaller cluster specific to lymphoid lineage cells (B, T and NK cells), consisting of miR-150 and miR-29 co -regulating TET3, ERP44 and VEGFA. [score:2]
[1 to 20 of 2 sentences]
84
[+] score: 8
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Five conserved miRNAs showed significant and consistent changes in copy number after song exposure across three biological replications of the song-silence comparison, with two increasing (tgu-miR-25, tgu-miR-192) and three decreasing (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p). [score:1]
Three miRNAs consistently decreased after song (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p) and two increased (tgu-miR-25, tgu-miR-192). [score:1]
[1 to 20 of 4 sentences]
85
[+] score: 8
Our study revealed that, among these, miR-17-5p, miR-20, miR-25, miR-92-1, miR-92-2, miR-93-1 and miR-106a were significantly up-regulated in MSS versus MSI-H colon cancer. [score:4]
Figure 3A shows the expression of miR-25 and miR-92 as detected by Northern blot. [score:3]
Membranes were hybridized with oligonucleotide probes, corresponding to the complementary sequences of the following mature miRNAs: miR-25 (TCA GAC CGA GAC AAG TGC AAT G) and miR-92 (CAG GCC GGG ACA AGT GCA ATA). [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 8
For instance, the paralog miRNA clusters miR-106a/363 (integrated by miR-106a, miR-363, miR-92-2, miR-19b-2, miR-20 and miR-18b), miR-106b/25 (compound of miR-106b, miR-25 and miR-93) and miR-17/92 (comprising miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) are down-regulated upon differentiation, while clusters miR-29a/29b and miR221/222 are strongly up-regulated, suggesting an important role for coordinate regulatory miRNA networks during GIC differentiation. [score:8]
[1 to 20 of 1 sentences]
87
[+] score: 8
In addition to miR-451, -486-5p, and −100, two additional miRNAs were identified as significantly up-regulated in the low titer group (miR-25 and let-7b) both of which were also identified as significantly dysregulated in tumor tissue, although let-7b had been identified as down-regulated (Figure 5A). [score:8]
[1 to 20 of 1 sentences]
88
[+] score: 8
Interestingly, CEBPA, which was upregulated four-fold in our HES1 cells upon differentiation, is predicted to be itself regulated by miR-124, miR-25, miR-363 and miR-367 (among others) according to TragerScan 4.2, all of which were downregulated at least 1.5-fold in differentiated HES1 cells. [score:8]
[1 to 20 of 1 sentences]
89
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
MiRNA expression profiling in sputum of subjects exposed to ozone inhalation revealed significantly up-regulated expression of 10 miRNAs: miR-132, miR-143, miR-145, miR-199a-3p, miR-199b-5p, miR-222, miR-223, miR-25, miR-424 and miR-582-5p [94]. [score:8]
[1 to 20 of 1 sentences]
90
[+] score: 8
reported here are in line with those reported in the literature describing miR-25, miR-221 and miR-222 as direct regulators of CDKN1C expression in a wide variety of solid tumours, showing a new mechanism responsible for CDKN1C downregulation in carcinogenesis [43– 45]. [score:8]
[1 to 20 of 1 sentences]
91
[+] score: 8
Eight key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were identified and predicted to regulate 89% of the targets in this network. [score:4]
From integrated genomic analysis, 8 key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were predicted to regulate 89% of the miR targets in the network [26]. [score:4]
[1 to 20 of 2 sentences]
92
[+] score: 8
In addition, Gong et al. [37] demonstrated that miR-25 promoted gastric cancer progression by directly down -regulating FBXW7 expression. [score:5]
Gong J Cui Z Li L Ma Q Wang Q Gao Y Sun H MicroRNA-25 promotes gastric cancer proliferation, invasion, and migration by directly targeting F-box and WD-40 Domain Protein 7, FBXW7Tumour Biol. [score:3]
[1 to 20 of 2 sentences]
93
[+] score: 7
In GC, miR-192, miR-215, miR-25 are reported to be upregulated, whereas miR-375, miR-101 are downregulated [9– 12]. [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 7
Other miRNAs from this paper: hsa-mir-216a
It has been recently reported that microRNA-25 (miR-25), whose expression is down-regulated in CRC tissue, is a negative regulator of Smad7, raising the possibility that in CRC cells high Smad7 can be linked to the low content of miR-25 [69]. [score:7]
[1 to 20 of 1 sentences]
95
[+] score: 7
However, several senescence -associated miRNAs (miR-15b, miR-25, miR-106b) are either not changed significantly or showed more interindividual variability in our miRNome analysis, suggesting that some but not all miRNAs expression patterns are consistent between senescent cells and aged cells. [score:3]
These subsets of miRNAs and others appear to target different senescence -associated genes, including several that encode cell cycle proteins (the miR-106b group), MKK4 (miR-15b, miR-24, miR-25, miR-141), p16 [INK4a] (miR-24), and IL-6/IL-8 (miR-146a/b) [16], [17], [18], [19]. [score:3]
These include miR-106b, miR-93, miR-25 and miR-15b, miR-24, miR-25, and miR-141 [16], [17]. [score:1]
[1 to 20 of 3 sentences]
96
[+] score: 7
Normalization with let-7d/g/i revealed significant upregulation of miR-25, miR-214, miR-223 and miR-483-5p in serum from cancer patients compared with normal controls (Figure 5B). [score:3]
As controls, we analyzed miR-20a [35], miR-21 [33, 36, 37], miR-24 [35] and miR-25 [35, 37], the levels of which have previously been shown to be significantly dysregulated in serum from cancer patients. [score:2]
Furthermore, we selected endogenous miR-25, miR-214, miR-223 and miR-483-5p as targets because they are well-characterized oncogenic miRNAs that have been shown to be elevated in sera from cancer patients [5, 35, 37]. [score:1]
However, normalization with U6 or miR-191 revealed no significant differences in miR-25, miR-214, miR-223 or miR-483-5p levels in serum from cancer patients versus controls (Figure 5B). [score:1]
[1 to 20 of 4 sentences]
97
[+] score: 7
Other miRNAs tested, miR-27 and miR-25/32/92/363/367 have highly conserved binding sites but did not have an effect on reporter gene expression in HEK293 or 501mel cells. [score:3]
All Mitf 3′UTR sequences in 11 vertebrate species analysed contain the miR-27, miR-25/32/92/363/367 and the miR-101/144 binding sites (Fig. 1B). [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
We tested the effects of microRNAs which have conserved binding sites in the 3′UTR region of Mitf, including miR-27a (located at 229–235 in the mouse Mitf 3′UTR sequence), miR-25/32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR-124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931–2937) (Fig. 1A and 1B). [score:1]
[1 to 20 of 5 sentences]
98
[+] score: 7
In this sense, Jones et al. [9] demonstrated that miR-25 is upregulated in OA chondrocytes whereas Iliopoulos et al. [15] stated that this miRNA was downregulated in OA cartilage. [score:7]
[1 to 20 of 1 sentences]
99
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study. [score:7]
[1 to 20 of 1 sentences]
100
[+] score: 7
Another interesting upregulated cluster in both PSC and MPC is located on chromosome 13 (Chr13.2), which includes members of the families miR-17, miR-19 and miR-25. [score:4]
For example, four families (mir-17, mir-19, mir-25 and mir-363) are located at three different clusters (at cluster 7.4, cluster 13.2, and cluster X. 8). [score:1]
In the case of MPC, the most distinctive family apart from the miR-302, is the miR-25 (miR-25, miR-92a and miR-92b). [score:1]
There are also some other families in the PSC population, such as miR-290, miR-373, miR-21 and miR-25. [score:1]
[1 to 20 of 4 sentences]