sort by

424 publications mentioning hsa-mir-26a-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-26a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 373
d EZH2 siRNA transfection in HCC cells eliminated the difference in E-cadherin miR-26 overexpression and down-regulation Because EZH2 reportedly down-regulates E-cadherin expression [19, 25], we transfected our two HCC cell lines with EZH2 small interfering RNA (siRNA) to explore whether miR-26a could regulate E-cadherin expression by directly targeting EZH2 expression. [score:19]
d EZH2 siRNA transfection in HCC cells eliminated the difference in E-cadherin miR-26 overexpression and down-regulationBecause EZH2 reportedly down-regulates E-cadherin expression [19, 25], we transfected our two HCC cell lines with EZH2 small interfering RNA (siRNA) to explore whether miR-26a could regulate E-cadherin expression by directly targeting EZH2 expression. [score:19]
Through down-regulation of EZH2 expression and up-regulation of E-cadherin expression, miR-26a inhibited the EMT process in vitro and in vivo. [score:13]
a assay showed that miR-26a down-regulated EZH2 expression and up-regulated E-cadherin expression. [score:10]
f Patients with high miR-26a expression had significantly lower EZH2 expression compared with those with low miR-26a expression (P = 0.004) Fig. 5 The proposed molecular mechanism was shown in a diagram In our previous study [18], the expression levels of miR-26a were modified in two human hepatoma cell lines, HepG2 and HCCLM3, and subclones with stable expression of miR-26a were established. [score:10]
In our previous study, we found that miR-26a indirectly suppresses tumor progress in HCC by inhibiting tumor angiogenesis and suppressing intratumoral macrophage infiltration [14, 18]. [score:8]
In contrast, HCCLM3-anti-miR-26a tumors showed a significant reduction of E-cadherin expression, with up-regulated expression of N-cadherin and vimentin (the area of positive staining, 17,245.5 ± 5560.9 vs 41,578.8 ± 8220.3; 90,067.7 ± 12,891.1 vs 36,617.1 ± 5303.3; 27,053.1 ± 3910.9 vs 11,537.5 ± 2455.4; P < 0.05 for all, Fig.   3d). [score:8]
It was reported that miR-26a mediated E-cadherin expression, the hallmark of EMT, in oral tongue squamous cell carcinoma, and the enhancer of zeste homolog 2 (EZH2) was the presumed key molecule that mediated miR-26a -induced down-regulation of E-cadherin expression [19]. [score:8]
Our results showed that miR-26a inhibited EMT through targeting EZH2 expression. [score:7]
These results indicate that miR-26a expression inhibited tumor progression in vivo and targeting EZH2-related EMT process may have been one of the main mechanisms. [score:7]
Patients with high miR-26a expression had significantly lower EZH2 expression than those with low miR-26a expression (the area of positive staining, 148,246.9 ± 115,257.0 vs 231,286.3 ± 79,644.3, P = 0.004, Fig.   4f). [score:7]
analysis showed that EZH2 expression was decreased after transfection with pre-miR-26a in HepG2 cells and increased after down-regulation of miR-26a in HCCLM3 cells compared to respective controls, while the expression of E-cadherin showed the opposite results (Fig.   2a). [score:7]
miR-26a expression was consistent with E-cadherin expression and inversely correlated with EZH2 expression in human HCC tissue. [score:7]
Furthermore, the expression of miR-26a was positively correlated with E-cadherin expression and inversely correlated with EZH2 expression in human HCC tissue. [score:7]
Overexpression and down-regulation of miR-26a were induced in these cell lines, and and immunofluorescence assays were used to detect the expression of EMT markers. [score:7]
Patients with high miR-26a expression had significantly higher E-cadherin expression compared with those with low miR-26a expression (the area of positive staining, 352,159.7 ± 108,722.0 vs 264,432.9 ± 91,518.7 P = 0.003, Fig  4c). [score:6]
miR-26a has been reported to suppress tumor growth and metastasis of HCC through the interleukin (IL)-6-Stat3 signaling pathway [16], and down-regulation of miR-26a in tumor tissue was associated with poor overall survival for patients who underwent curative surgery for HCC [17]. [score:6]
f Patients with high miR-26a expression had significantly lower EZH2 expression compared with those with low miR-26a expression (P = 0.004) Fig. 5 The proposed molecular mechanism was shown in a diagram miR-26a plays a critical role in various types human cancers [17, 27, 28]. [score:6]
c Patients with high miR-26a expression had significantly higher E-cadherin expression compared with those with low miR-26a expression (P = 0.003). [score:6]
miR-26a inhibited the EMT process in HCC by down -regulating EZH2 expression. [score:6]
Here, we first demonstrated that miR-26a inhibits the EMT process by regulating EZH2 expression in HCC through a cell-autonomous mechanism (Fig.   5). [score:6]
Previous study showed that miR-26a was down-regulated in HCC tumor samples with a poor prognosis, while high levels of miR-26a expression were associated with a good prognosis for patients who underwent curative liver resection [17]. [score:6]
These results suggest that miR-26a directly interacted with EZH2 mRNA and inhibited the expression of EZH2. [score:6]
The results show that EZH2 siRNA reduced E-cadherin expression and eliminated the difference in E-cadherin expression between HepG2-control and HepG2-miR-26a (Fig.   2d, left) and between HCCLM3-control and HCCLM3-anti-miR-26a (Fig.   2d, right). [score:5]
In our previous study [18], the expression levels of miR-26a were modified in two human hepatoma cell lines, HepG2 and HCCLM3, and subclones with stable expression of miR-26a were established. [score:5]
Since EMT has been critically discussed as the key process in tumor aggressiveness and metastasis [46], our findings in the present study demonstrate that miR-26a as a suppressive miRNA could inhibit tumor metastasis and invasion partly by impeding EMT through repression of EZH2. [score:5]
Moreover, our previous study found that miR-26a inhibited HCC tumor growth and metastasis by modulating tumor microenvironment (e. g., inhibiting the tumor angiogenesis [15] and macrophage infiltration [14]). [score:5]
In addition, EZH2 expression (Fig.   4d) was found to be inversely associated with miR-26a expression (R = −0.472, P = 0.001, Fig.   4e). [score:5]
In the present study, miR-26a was found to be inversely correlated with EZH2 expression in the HCC cells and HCC tissues, and overexpression of miR-26a decreased the luciferase reporter activity of the wild-type 3′-UTR of EZH2 but not the mutant 3′-UTR. [score:5]
In the HepG2 groups, higher expression of E-cadherin and lower expression of N-cadherin and vimentin were found in the HepG2-miR-26a group in comparison to those in the HepG2-control group (the area of positive staining, 89,588.7 ± 10,305.1 vs 39,017.3 ± 6326.9; 18,865.1 ± 3244.4 vs 88,272.7 ± 9656.7; 16,910.5 ± 3601.1 vs 45,127.5 ± 3593.1; P < 0.05 for all, Fig.   3d). [score:5]
Fig. 4The relationships between miR-26a expression and the expression of EZH2 and E-cadherin in human HCC tissue. [score:5]
After 24 h, cells were transfected with 50 ng of miR-26a expression vector, miR-26a inhibitor, control vector, or negative control. [score:5]
The data support that miR-26a could inhibit EMT by repressing the expression of EZH2. [score:5]
A total of 67 cases were used in this study to examine EZH2 expression, with 52 of the 67 HCC patients expressing miR-26a. [score:5]
miR-26a was reported to suppress tumor growth by targeting EZH2 in some tumors [23, 24]. [score:5]
Our previous study reported that microRNA-26a (miR-26a) inhibited tumor progression by inhibiting tumor angiogenesis and intratumoral macrophage infiltration in hepatocellular carcinoma (HCC). [score:5]
E-cadherin expression was found to be positively associated with miR-26a expression (R = 0.462, P = 0.001, Fig.   4b). [score:5]
These results indicate that down-regulation of miR-26a induced EMT in HCC cells. [score:4]
d Immunohistochemistry revealed that E-cadherin expression was decreased and the expression level of N-cadherin and vimentin was increased in HCCLM3-anti-miR-26a tumors compared to HCCLM3-controls. [score:4]
Fig. 1Down-regulation of miR-26a induced EMT in hepatoma cells in vitro. [score:4]
These results indicate that miR-26a significantly inhibited tumor growth and lung metastasis in vivo, along with down -regulating EMT-related makers. [score:4]
Moreover, luciferase reporter assay was performed to determine whether miR-26a directly regulated EZH2 expression in HCC cells. [score:4]
Down-regulation of miR-26a in HCCLM3 and HepG2 cells resulted in an EMT-like cell morphology and high motility in vitro and increased in tumor growth and pulmonary metastasis in vivo. [score:4]
Immunohistochemical assays were conducted to study the relationships between miR-26a expression and enhancer of zeste homolog 2 (EZH2) and E-cadherin expression in human HCC samples. [score:4]
Down-regulation of miR-26a is associated with EMT in tumor cells. [score:4]
c Quantification of bioluminescence of lung metastatic foci showed that down-regulation of miR-26a significantly accelerated pulmonary metastasis (arrows indicate metastatic foci in lung). [score:4]
miR-26a regulated EMT by targeting EZH2. [score:4]
No pulmonary metastases occurred in HepG2-control xenografts and HepG2-miR-26a (up-regulation miR-26a) xenografts based on quantification of bioluminescence. [score:4]
The target sequence of EZH2 3′UTR (wt 3′UTR), which contained a miR-26a putative binding site, could be mutated, or a mutant sequence (mt 3′UTR) messenger RNA (mRNA) was cloned downstream of the luciferase reporter gene vector (Fig.   2b). [score:3]
Although some studies have shown that it may function as an oncogene in malignant glioma, lung cancer, cholangiocarcinoma, and chronic lymphocytic leukemia [29– 31], emerging evidence demonstrates that miR-26a may serve as a potential tumor suppressor in other malignant tumors [17, 32– 35]. [score:3]
In the HepG2 groups, the expression of EZH2 in HepG2-control group was significantly higher than that in the HepG2-miR-26a group (the IOD of positive staining, 26,594.3 ± 3067.9 vs 13,511.8 ± 2319.9, P < 0.005, Fig.   3d). [score:3]
e An inverse association between miR-26a and EZH2 expression were found (R = −0.472, P = 0.001). [score:3]
The miR-26a expression data were obtained from our previous study. [score:3]
The data also suggest that miR-26a could be a marker and potential therapeutic target in HCC patients in the future. [score:3]
The results further support an inverse relationship between miR-26a and EZH2 expression in human HCC tissue. [score:3]
Moreover, some reports have found that miR-26a strongly reduces the expression of EZH2 in some tumors [23, 34, 43]. [score:3]
b miR-26a was positively associated with intratumoral E-cadherin expression (R = 0.462, P = 0.001). [score:3]
Using a median value of miR-26a expression as a cutoff point, we divided the 52 cases of HCC patients into two groups. [score:3]
As described in our previous study [18], to modify miR-26a expression levels in HCC cell lines, we obtained recombinant lentivirus vectors from Genechem (Shanghai, China) that included genes such as pre-miR-26a, the negative control precursor miRNA; anti-miRNA-locked nucleic acids (LNAs) against miR-26a; and the negative control of anti-miRNA-LNAs. [score:3]
miR-26a expression data were obtained in our previous study [17]. [score:3]
miR-26a inhibited tumor growth and EMT in vivo. [score:3]
However, whether miR-26a plays a crucial role in EMT regulation and its underlying mechanism in HCC remains unknown. [score:2]
microRNA-26a (miR-26a), a member of the miR-26 family, has been considered to be a potential tumor suppressor in HCC [14, 15]. [score:2]
The direct roles of miR-26a on tumor cell invasion remain poorly understood. [score:2]
In HepG2-miR-26a tumors, EMT markers were inhibited compared to HepG2-controls. [score:2]
However, how miR-26a modulates tumor progression in a direct manner remains poorly understood. [score:2]
Mice with HCCLM3-anti-miR-26a tumors had lower body weights (18.6 ± 2.3 vs 21.2 ± 1.5 g 36 days after mo del establishment, P = 0.037) and larger tumors (973.5 ± 334.2 vs 515.6 ± 165.4 mm [3], P = 0.019, Fig.   3a) than those with HCCLM3-control tumors. [score:1]
Fig. 2EZH2 played a critical role in miR-26a modulating EMT process. [score:1]
No pulmonary metastases were detected in the mouse mo dels established with HepG2, a hepatoma cell line without potential for lung metastasis [26], including HepG2-miR-26a and HepG2-control cells (Fig.   3c). [score:1]
b Diagram of the putative binding sequence of miR-26a in the 3′-UTR containing reporter constructs of EZH2 is shown. [score:1]
Moreover, more pulmonary metastatic foci occurred in the HCCLM3-anti-miR-26a group than in the HCCLM3-control group (6.8 ± 1.7 vs 2.3 ± 1.0, P = 0.001, Fig  3c), which was shown in both bright field (b) and fluorescence (f) imaging. [score:1]
Our preliminary study did not explore the effect of the HCC environment on miR-26a or EMT. [score:1]
However, they did not exclude other signal pathways that may modulate EMT and could be mediated by miR-26a. [score:1]
In this study, we aim to explore the mechanism of miR-26a in modulating epithelial-mesenchymal transition (EMT) in HCC. [score:1]
To explore the role of miR-26a in tumor growth and metastasis, orthotopic nude mouse mo dels were established with HepG2 and HCCLM3 cell lines. [score:1]
EMT epithelial-mesenchymal transition EZH2 enhancer of zeste homolog 2 HCC hepatocellular carcinoma IL-6 interleukin-6 miR-26a microRNA-26a This study was supported by the National Natural Science Funds of China (No. [score:1]
The activity of the mt 3′UTR vector was unaffected by a simultaneous transfection with miR-26a (Fig.   2c, right). [score:1]
a, b HCC subcutaneous tumor tissues (HCCLM3-control, HCCLM3-anti-miR-26a, HepG2-control, and HepG2-miR-26a) were implanted into nude mouse livers to establish the xenograft HCC mo dels. [score:1]
Luciferase reporter assay showed that miR-26a directly interacted with EZH2 messenger RNA (mRNA). [score:1]
In the present study, we aimed to investigate the functional role of miR-26a in EMT and consider its potential as a therapeutic target in HCC. [score:1]
microRNA-26a (miR-26a) Hepatocellular carcinoma (HCC) Enhancer of zeste homolog 2 (EZH2) Epithelial-mesenchymal transition (EMT) Liver cancer (mostly hepatocellular carcinoma [HCC]) is the sixth most prevalent cancer worldwide [1], and it is the second most frequent cause of cancer-related death in men and the sixth most frequent in women [2]. [score:1]
More importantly, the effects of miR-26a modulation on EMT in HCC were affected by the EZH2 siRNA. [score:1]
These subclones were HepG2-wt (wild type of HepG2), HepG2-control (HepG2 transfected with the negative control of precursor miRNA), and HepG2-miR-26a (HepG2 transfected with pre-miR-26a), and HCCLM3-wt (wild type of HCCLM3), HCCLM3-control (HCCLM3 transfected with the negative control of anti-miRNA-LNAs), and HCCLM3-anti-miR-26a (HCCLM3 transfected with anti-miRNA-LNAs against miR-26a). [score:1]
However, the underlying mechanisms associated with miR-26a in HCC invasion are still not fully understood. [score:1]
[1 to 20 of 84 sentences]
2
[+] score: 329
Expression of tlr3 and miR-26a was monitored in PIA rat spleens and the results showed that tlr3 mRNA expression was sharply upregulated 3-fold (P <0.01), whereas miR-26a expression significantly decreased by 60% on average. [score:10]
These findings demonstrate that miR-26a regulates the TLR3 signaling pathway by targeting TLR3 expression, and implicates miR-26a as a drug target for inflammatory suppression in arthritis therapy. [score:10]
Microarray -based miRNA expression profiling found that MYC oncogene could repress miR-26a [35], Trastuzumab could induce mir-26a and hence, produces therapeutic actions in human epidermal growth factor receptor-2 (HER2) -positive breast cancer cells [36], C/EBP-α can directly activate mir-26a expression during mechanical stretch, which leads to hypertrophy of human airway smooth-muscle cells [37], and menin, a transcriptional factor has been demonstrated by chromatin immunoprecipitation (ChIP) to occupy the mir-26a gene promoter, thus inducing its expression, and confirming its role as a positive regulator of mir-26a [38]. [score:9]
In the mean time, western blotting results of TLR3 protein expression showed that 10nM miR-26a mimics were able to significantly suppress TLR3 protein expression by approximately 30% on average compared with the mock (P <0.05) or the NC group (P <0.05), and 10nM miR-26a inhibitors sharply increased TLR3 protein expression by 100% compared with the mock (P <0.05) or by 70% compared with the NC (P <0.05) (Figure 2C). [score:8]
TLR3 mRNA expression results showed that miR-26a mimics hardly affected tlr3 mRNA expression, however miR-26a inhibitors were able to raise tlr3 mRNA expression level by 3.7- or 1.9-fold respectively compared with the mock (P <0.05) or the NC (P <0.05) group (Figure 2B). [score:8]
TLR3 is intrinsically expressed in rodent macrophages, hence, in this work we chose the rat macrophage cell line NR8383 to explore the expression regulation of the TLR3 gene after miR-26a mimics or inhibitors were transfected into the cells. [score:8]
The present study was performed to find the potential miRNAs that can target the TLR3 molecule itself, verifying both the miRNA and TLR3 expression in macrophages during differentiation and pristane stimulation, as well as in the spleen of PIA rats, and observing the effects of an miR-26a mimic on TLR3 expression and arthritis severity in PIA rats. [score:7]
MiR-26a expression was downregulated as tlr3 expression was decreased in spleens of PIA rats, and both were rescued after MTX treatment in arthritic rats. [score:7]
At the end of this study, the miR-26a administration in PIA rats demonstrated that miR-26a overexpression can suppress TLR3 protein expression in vivo. [score:7]
MiR-26a was downregulated and TLR3 was upregulated during the induction of rat BMDM. [score:6]
In addition, upregulated miR-26a promotes myogenesis by post transcriptional repression of Ezh2, a known suppressor of skeletal muscle cell differentiation [34]. [score:6]
MiR-26a regulation on TLR3 gene expression was determined using and after miR-26a mimics and inhibitors were transfected into rat macrophage line NR8383 cells. [score:6]
In pristane-primed NR8383 cells, enhanced expression of tlr3 mRNA (P <0.05) and protein expression approximately 2-fold compared with the medium control, whereas miR-26a expression decreased by 40% on average (P <0.05) after 24 h pristane stimulation (Figure 4A and B). [score:6]
Our finding not only discloses the deregulation of miR-26a in TLR3 expression, but also offers a novel and reliable mechanism for abnormal TLR3 overexpression in experimental arthritis. [score:6]
Responding to this increasing miR-26a expression, TLR3 protein expression displayed dose -dependent inhibition by approximately 30%, 50% and 70% respectively, compared with the NC group (Figure 2D). [score:6]
The cells were transfected with miR-26a inhibitors and miR-26a expression was suppressed by 99% compared with the NC (P <0.05) or mock (P <0.05) group, suggesting that a gain or loss of miR-26a function occurred (Figure 2A). [score:6]
We found reduction of miR-26a expression in rat macrophages during BMDM induction, pristane stimulation and in spleens of PIA rats in which TLR3 was overexpressed. [score:5]
Sequences from 5′ to 3′ end are listed as follows: NC mimics sense UUCUCCGAACGUGUCACGUTT, anti-sense ACGUGACACGUUCGGAGAATT; miR-26a mimics sense UUCAAGUAAUCCAGGAUAGGCU, anti-sense CCUAUCCUGGAUUACUUGAAUU; NC inhibitor CAGUACUUUUGUG UAGUACAA (2′Ome -modified), miR-26a inhibitor AGCCUAUCCUGGAUUACUU GAA (2′Ome -modified). [score:5]
The incubation with miR-26a mimics/inhibitors was performed for a further 24 h and pristane stimulation for another 24 h to confirm the target repression of TLR3 signaling by miR-26a in macrophages. [score:5]
In this case, endogenous miR-26a might be sufficient for buffering TLR3 expression fluctuation in inactivated macrophage so that miR-26a inhibitor treatment exhibits a more powerful function than its mimics. [score:5]
Different doses of miR-26a mimics were transfected into NR8383 cells to confirm the translational suppression. [score:5]
Modifications of miR-26a function by transfection of miR-26a mimics and inhibitors exhibited corresponding repression and augmentation of TLR3 and its signaling downstream cytokine expressions in NR8383 cells. [score:5]
MiR-26a negatively regulates TLR3 signaling via targeting of TLR3 itself in rat macrophages, and this finding provides a novel insight into abnormal TLR3 overexpression during experimental arthritis. [score:5]
The alteration of miR-26a expression was negatively related with TLR3 expression during BMDM induction, in pristane-primed NR8383 cells and PIA rat spleens. [score:5]
To find out whether miR-26a could control TLR3 signaling, NR8383 were incubated with 10 nM mimics or inhibitors for 24 h prior to activation of TLR3 signaling by poly I:C stimulation for another 24 h, and then harvested for expression analysis. [score:5]
Along with macrophage induction, tlr3 mRNA was upregulated 5- and 9-fold, whereas the miR-26a expression declined by 60% and 70% respectively on days 3 and 6 compared with day 0 after BMDM induction (Figure 3A). [score:5]
The miR-26a mimic treatment displayed the depression of TLR3 expression and ameliorated the disease severity in the rats with pristane induced arthritis. [score:5]
Direct target relationship between miR-26a and tlr3 mRNA in rats was confirmed. [score:4]
In addition, miR-26a was verified to be involved in the negative regulation of TLR3 signaling by targeting TLR3 itself in macrophages, and modifications of miR-26a function exhibited corresponding repression or augmentation of TLR3 signaling. [score:4]
MiR-26a -mimic administration also could lead to suppression of TLR3 protein expression and ameliorate arthritis in PIA rats. [score:4]
TLR3 protein expression in the spleen was significantly suppressed in the PIA + miR-26a group compared with the PIA + NC group or PIA + saline group (Figure 6G). [score:4]
The mutated tlr3 3′UTR element containing site mutations at numbers 2, 4, and 6 in the putative miR-26a: tlr3 seed-pair region was obtained using the PCR-directed mutation method and cloned into the same vector, namely the mutated pMIR-TLR3 vector. [score:4]
Successful transfection was confirmed by miR-26a expression monitored by, and the results showed that alteration of miR-26a function could regulate TLR3 signaling after pristane stimulation in macrophages. [score:4]
MiR-26a mimic was administrated to PIA rats, and the results showed that TLR3 protein expression was suppressed, and the arthritis severity alleviated. [score:4]
For example, it has been reported that miR-26a plays a crucial role in regulating mouse hepatocyte proliferation during liver regeneration [32], and it could also modulate osteogenic differentiation of human adipose tissue-derived stem cells by targeting SMAD1 transcription factor [33]. [score:4]
Similarly, TNF-α protein concentration in the cell supernatant was detected using ELISA, and the results showed that it was significantly suppressed (P <0.05) after miR-26a mimic treatment, and enhanced (P <0.05) after inhibitor treatment compared with the mock or NC group (Figure 4E). [score:4]
In BMDM induction and pristane-stimulated NR8383 cells, miR-26a reduction was found to be responsible for TLR3 overexpression in rat macrophages. [score:3]
ELISA results also showed that the TNF-α protein concentration in the cell supernatant was also significantly suppressed after miR-26a mimic treatment compared with the NC (P <0.05), and enhanced after inhibitor treatment compared with both the mock and NC groups (both P <0.05) (Figure 2G). [score:3]
In bioinformatics, we found that miR-26a targets TLR3 in the rat, mouse, rabbit, bushbaby and armadillo; however, the binding pattern of TLR3:miR-26a disappears in the human genome with two nucleotide mutations at the seed region compared with the rat genome. [score:3]
These results indicated that miR-26a mimic finely controlled TLR3 protein expression and ameliorated arthritis severity in the PIA rats. [score:3]
Briefly, both the firefly pMIR-Report™ Luciferase (Ambion) and renilla pRL-TK (Promega) vectors (90 ng:10 ng per well) were transfected into Hela cells (2 × 10 [4] cells per well seeded for 24 h before transfection) simultaneously with 10 nM miR-26a mimic/inhibitor (GenePharma, Shanghai, China) or negative control (NC) using Lipofectamin 2000™ (Invitrogen, Carlsbad, USA) transfection reagents in a 48-well culture plate. [score:3]
Bioinformatics results showed that miR-26a and miR-340-5p were candidate miRNAs for targeting rat TLR3 (Figure 1A). [score:3]
To sum up, we predicted miR-26a to be a candidate to target TLR3 in rats and many other mammals. [score:3]
However, both tlr3 excess expression and miR-26a reduction after MTX treatment surprisingly recovered to the levels of control rats (Figure 5C). [score:3]
Dual luciferase reporter assay was used to validate the direct interaction between miR-26a (a candidate miRNA to target tlr3 mRNA) and tlr3 3′UTR. [score:3]
MiR-26a mimics exhibited corresponding repression of TLR3 protein by 40% and 25% compared with the NC or mock group, whereas miR-26a inhibitors increased TLR3 expression 1.6-fold compared with the NC or mock (Figure 4D). [score:3]
results showed that miR-26a and miR-340-5p were candidate miRNAs for targeting rat TLR3 (Figure 1A). [score:3]
Figure 4 miR-26a and toll-like receptor (TLR)3 expression in rat macrophages after pristane stimulation in vitro. [score:3]
Figure 1 Putative target relationship between miR-26a and toll-lke receptor (TLR)3 in rats. [score:3]
After pristane activation, miR-26a mimics repressed tlr3 mRNA by 30% and protein by 40%, and its inhibitors also increased tlr3 mRNA by 40% and protein 1.6-fold. [score:3]
To observe whether miR-26a overexpression in vivo can influenze arthritis severity, PIA rats were treated with miR-26a mimic, NC mimics and saline four times until rats were sacrificed (Figure 6A). [score:3]
Expressions of TLR3 and miR-26a were detected during rat bone marrow derived macrophage (BMDM) induction, in pristane stimulated NR8383 cells and spleens from methotrexate (MTX) treated PIA rats. [score:3]
Figure 5 miR-26a and toll-like receptor (TLR)3 expression in pristine -induced arthritis (PIA) rats with and without treatment with methotrexate (MTX). [score:3]
MiR-26a expression in spleens from the PIA + miR-26a group remained 2.5 times higher than in the NC group, even after the last mimic administration four days previously (Figure 6F). [score:3]
Attached cells on days 0, 3 and 6 were harvested for miR-26a and TLR3 expression analyses. [score:3]
Figure 3 miR-26a and toll-like receptor (TLR)3 expression during bone marrow-derived macrophage (BMDM) induction. [score:3]
On the contrary, the miR-26a inhibitor significantly elevated (P <0.05) the luciferase activity of pMIR-TLR3 vector by 70% on average compared with the NC inhibitor or by 80% compared with the empty pMIR vector. [score:3]
In previous reports, miR-26a was on the list of the top 10% of miRNAs constitutively expressed at a high level in rat spleen [30], and also found to be considerable abundant in rat articular cartilage using Solexa sequencing from our previous study [31]. [score:3]
Target relationship between tlr3 mRNA 3′UTR and miR-26a was analyzed by dual luciferase reporter assay, pMIR-REPORT™ Luciferase vectors with or without tlr3 mRNA 3′UTR element (pMIR-TLR3 or pMIR empty vectors) were transfected into Hela cells, and pRL-TK vector was used as an internal control reporter in all conditions for normalization. [score:2]
Mir-26a genes are present on chromosome 3p22.2 and 12q14.1 in the human genome and 8q32 in the rat genome, and mir-26a itself could be regulated. [score:2]
In the inactivated phase, miR-26a mimics hardly affected tlr3 mRNA, yet repressed its protein by 30%, whereas miR-26a inhibitors increased tlr3 mRNA 1.9-fold, and protein by 70% on average compared with the NC. [score:2]
The negative regulation of the TLR3 gene from miR-26a was revealed in inactive NR8383 macrophages, further in primary macrophages during BMDM induction, and also in pristine-stimulated NR8383 macrophages, confirming that miR-26a could control TLR3 signaling in rat macrophages. [score:2]
miR-26a mimics and inhibitors, respectively, caused a 30% reduction in 40% increase of tlr3 mRNA (P <0.05), a 30% reduction or 60% increase in ifn-β mRNA (P <0.05), and a 45% reduction or 2.5-fold increase in tnf-α mRNA (P <0.05) compared with the NC group (Figure 4C). [score:2]
MiR-26a also putatively targets TLR4 in humans, and in the chimpanzee, rhesus monkey, horse, elephant, tree shrew and tenrec. [score:2]
This putative targeting relationship between miR-26a and TLR3 was further confirmed by dual reporter gene assay. [score:2]
Putative targeting relationship between miR-26a and TLR3 in rats was confirmed by dual luciferase reporter gene assay. [score:2]
MiR-26a and TLR3 expression displayed an opposite trend in rat macrophages after pristane stimulation. [score:2]
Both double-stranded mimics and single-stranded inhibitors of miR-26a or the NC could activate tlr3 and ifn-β mRNA compared with the mock (P <0.05). [score:2]
To confirm whether TLR3 is the target of miR-26a, the firefly and renilla dual luciferase reporter assay was performed in Hela cells (Figure 1B). [score:2]
MiR-26a could negatively regulate TLR3 signaling by intervening in miR-26a function in macrophages. [score:2]
To further verify this specific binding, a mutated pMIR-TLR3 vector with a three-nucleotide mutation in the putative seed -binding site was constructed and transfected together with miR-26a mimics and pRL-TK into Hela cells (Figure 1C). [score:2]
Rescued miR-26a reduction and TLR3 overexpression in spleens from MTX -treated PIA rats compared with saline -treated ones also suggested the implication of miR-26a in rat arthritis. [score:2]
Previous studies on miR-26a have provided much evidence of this miRNA as an important regulator in cell proliferation and differentiation. [score:2]
The results showed that miR-26a mimics caused a 60% reduction, whereas inhibitors caused a 1.5-fold increase of TLR3 protein on average compared with both the NC and mock group (Figure 2E). [score:2]
MiR-26a and TLR3 expression was monitored after rat BMDM was induced for 0, 3 and 6 days. [score:2]
It seems that miR-26a regulation may transition from TLR3 to TLR4 in many other species. [score:2]
More interestingly, after TLR3 signaling activation, this negative regulation from miR-26a seemed to be amplified. [score:2]
PIA rats were divided into three groups: PIA + saline, PIA + negative control (NC) and PIA + miR-26a. [score:1]
The arthritis clinical score showed that miR-26a could not prevent the occurrence of arthritis from the beginning, but could significantly restrain the arthritis severity after the third injection on day 15 till the rats were sacrificed on day 23 (Figure 6B). [score:1]
According to miRBase [29], an authoritative miRNA database, miR-26a belongs to one of the miRNA families broadly conserved with perfectly identical sequences among vertebrates. [score:1]
pMIR-REPORT™ Luciferase vector carrying a TLR3 mRNA 3′UTR element with the putative binding site of miR-26a was transfected into Hela cells (upper panel). [score:1]
Implication of miR-26a found in PIA rat spleens. [score:1]
Figure 2 Effects of miR-26a on toll-like receptor (TLR)3 signaling by gain or loss of miR-26a function in NR8383. [score:1]
Arthritis was induced in rats using pristane at day 0 and then rats were treated with miR-26a mimic, NC mimics or saline (150 μg/kg, equal to 11.4 nmol/kg molecules dissolved in saline each time) through i. p. injection four times, on days 8, 12, 15 and 19. [score:1]
MiR-26a miR-Up™ agomir molecule, which was cholesterol -modified at the 3′ end, with two phosphorthioations at the 5′ end and four at the 3′ end, and methylation for all skeletons, was purchased from the company (GenePharma, China) and used as a miR-26a mimic. [score:1]
miR-26a inhibitors caused a 60% increase of ifn-β mRNA compared with both (P <0.05) the NC and mock, and a 100% increase of tnf-α mRNA compared with the NC (P <0.05) (Figure 2F). [score:1]
There was no significant difference in the organ-/body-weight ratio in the spleen, inguinal lymph nodes, heart, liver, lung or kidney, indicating therapy in both the NC and miR-26a miRNA (Additional file 1). [score:1]
Ankle (Figure 6C) and food-pad perimeter (Figure 6D) in the PIA + miR-26a group was significantly lower than in the PIA + saline or PIA + NC group on day 23, indicating relief of joint-swelling after miR-26a mimic treatment (Additional file 1). [score:1]
Click here for file Figure showing other arthritis-parameter changes after miR-26a mimic treatment in pristine -induced arthritis (PIA) rats. [score:1]
The ELISA test also showed that the plasma TNF-α in PIA + miR-26a rats was lower than in the PIA + saline rats (Figure 6H). [score:1]
A 198-bp-long tlr3 3′UTR element containing the putativebinding site of miR-26a (miR-26a sequence: 5′-UUCAAGUAAUCCAGGAUAGGCU-3′) was cloned downstream of the luciferase gene between the SacI and HindIII sites within the pMIR-Report™ Luciferase (Ambion, Austin, USA) vector to construct a pMIR-TLR3 vector. [score:1]
Figure showing other arthritis-parameter changes after miR-26a mimic treatment in pristine -induced arthritis (PIA) rats. [score:1]
Schematic diagram of pairing relationship between miR-26a and wild-type or mutated pMIR-TLR3 vector indicates that three nucleotides have been altered in the mutated pMIR-TLR3 vector (lower panel). [score:1]
This study was performed to determine the relationship between miR-26a and TLR3 in rat macrophages and to observe effects of miR-26a mimic on pristane induced arthritis (PIA) in rats. [score:1]
The rat tlr3 mRNA 3′UTR sequence contains a putative binding site of miR-26a analyzed by the bioinformatics software [28]. [score:1]
[1 to 20 of 95 sentences]
3
[+] score: 249
As shown in Figure 6A-B, the upregulation of miR-26a and downregulation of ITGA5 resulted in reduced phosphorylation of Akt and ERK1/2, whereas the total Akt and ERK levels were not affected, indicating both Akt and ERK1/2 signaling pathways could be the downstream of miR-26-ITGA5 axis. [score:7]
The miR-26a expression is significantly downregulated in HCC cells and especially in metastatic tumors. [score:6]
Our results provide the first evidence that, in aggressive HCCs, miR-26a governs tumor cell anoikis sensitivity, at least in part, by downregulating the expression level of ITGA5. [score:6]
These observations are in agreement with previous findings that miR-26a expression is down-regulated in parallel with hepatocellular cancerization and metastasis [23- 26]. [score:6]
Our analysis of mRNA array data from the Gene Expression Omnibus (GEO) repository show that downregulation of miR-26a is a frequent event during the metastasis of HCC in patients (Figure 1). [score:6]
Down-regulation of miR-26a expression in human HCC, especially in metastatic HCC tumors. [score:6]
To determine a role of miR-26a in anoikis, we used lentivirus- delivery system to stably overexpress miR-26a in two HCC cell lines (BEL-7404 and FHCC-98) and confirmed the expression level of miR-26a by qRT-PCR analysis (Figure 2A). [score:5]
Two recent reports show that both IL-6-Stat3 and HGF-Met oncogenic signaling pathways are negatively regulated by miR-26a in HCCs, suggesting that downregulation of miR-26a promotes proliferation, migration and invasion of tumor cells in vitro and in vivo [25, 26]. [score:5]
Expression levels of total miR-26a as the average expression levels of pre-miR-26a-1 and pre-miR-26a-2 from a normalized GEO dataset (GSE6857). [score:5]
Figure 2Stable over -expression of miR-26a promotes cell anoikis in vitro and in vivo(A) Relative miR-26a expression levels in BEL-7404(left) and FHCC-98(right) cells treated with Lv-Luc or Lv-miR-26a were determined by qRT-PCR. [score:5]
As shown in Figure 3G, overexpression of miR-26a strongly inhibits ITGA5 protein levels. [score:5]
However, it is unclear how the currently identified target genes of miR-26a contribute to its strong inhibitory effects on the malignant behaviors of HCC cells. [score:5]
Overexpression of miR-26a promotes HCC cells anoikis in vitro and in vivoMetastasis involves a series of sequential stages and the inhibition of anoikis plays a critical role in this complicated process [7]. [score:5]
Figure 3(A) Gene Ontology classification of miR-26a's potential target genes predicted by integrating the results of two algorithms (Targetscan and PicTar). [score:5]
This finding is consistent with previously reported data in other cohorts, further confirming the correlation of miR-26a expression and the development and progression of liver cancer. [score:4]
We then sought to determine whether exogenous miR-26a can regulate ITGA5 expression in HCC cells. [score:4]
Our findings combined with that of others indicate that miR-26a sits atop a regulatory pathway that inhibits multiple steps of the metastatic cascade, altering both the capacity of cancer cells to detach from a primary tumor and the ability of already disseminated neoplastic cells to survive in circulation system. [score:4]
Figure 6(A) analysis was performed to determine the phosphorylation of Akt(Ser473) in BEL-7404 cells after over -expression of miR-26a or knockdown of ITGA5. [score:4]
To test this, we infected miR-26a -expressing cells with lentivirus- delivered ITGA5 lacking the 3′UTR (Figure 5A-B). [score:3]
Reconstituted activation of ITGA5 inhibits miR-26a -induced anoikis in HCC cells. [score:3]
Furthermore, we examined the expression levels of miR-26a and ITGA5 in a panel of human HCC cell lines. [score:3]
To further confirm whether miR-26a is associated with metastasis of HCC, a normalized Gene Expression Omnibus (GEO) dataset (GSE6857) was analyzed. [score:3]
for miR-26a overexpressionSynthesized RNA duplexes of scramble miRNA (Negetive Control, NC) and miR-26a were obtained from GenePharma (Shanghai, China). [score:3]
We identified ITGA5, an integrin family member, as a bona fide functional target in miR-26a -induced anoikis. [score:3]
Although miR-26a may function as an oncogene in certain cell type contexts like malignant glioma, cholangiocarcinoma and chronic lymphocytic leukemia [35- 37], accumulating evidence demonstrates that in most of detected malignant tumors, miR-26a exhibits tumor -inhibitory properties. [score:3]
These findings indicate that ITGA5 is a potential target of miR-26a. [score:3]
Expression levels of ITGA5 and miR-26a were from two correlative normalized GEO datasets (GSE14520 & GSE6857). [score:3]
It has been important to determine the inhibitory effect of miR-26a on anoikis of HCC cells in vitro and in vivo. [score:3]
ITGA5 is a bona fide target gene of miR-26a. [score:3]
Constructs for miR-26a overexpression. [score:3]
Therefore, we predict that reconstitution of ITGA5 in miR-26a–expressing cells can antagonize the effects of miR-26a in this process. [score:3]
Strikingly, miR-26a, another well-documented tumor suppressor miRNA in HCC, is also demonstrated to be involved in a c-Myc and EZH2-controlled molecular network in lymphoma, prostate cancer and colorectal cancer [19- 22]. [score:3]
Our results suggest that reduction of ITGA5 levels has similar effects on the HCC cells to miR-26a overexpression, further confirming that ITGA5 may act as a downstream functional mediator of miR-26a during tumor cell anoikis. [score:3]
de/) databases to predict the putative target genes of miR-26a (Figure 3A). [score:3]
To identify the effectors of miR-26a -induced anoikis, we used combined analyses of TargetScan (http://www. [score:3]
Enhanced anoikis sensitivity by ITGA5 silencing mimicked the phenotype induced by overexpression of miR-26a in HCC cells. [score:3]
ITGA5 over -expression rescues phenotypes induced by miR-26a. [score:3]
Additional studies are still required to identify the mechanism of tumor suppression by miR-26a thereby shedding light on the complex molecular network of HCCs. [score:3]
Taken together, our findings show that ITGA5 reintroduction can abrogate miR-26a–induced anoikis, suggesting that ITGA5 is a functional target of miR-26a in HCC cells. [score:3]
Pre-miR-26a-1, pre-miR-26a-2 and mature miR-26a expression profiling in HCC was downloaded from a normalized GEO dataset (GSE6857). [score:3]
Stable over -expression of miR-26a promotes cell anoikis in vitro and in vivo. [score:3]
The pleiotropic anti-metastatic capabilities of miR-26a seem to position this tumor suppressive miRNA as a critical safeguard against the acquisition of metastatic competence. [score:3]
In this study, we discovered that overexpression of miR-26a sensitizes resistant tumor cells to anoikis (Figure 2). [score:3]
Moreover, adeno -associated virus (AAV) -mediated systematic administration of miR-26a potentially inhibits tumor growth in a spontaneous murine liver cancer mo del [24]. [score:3]
In this study, we discovered that overexpression of miR-26a promotes anoikis of HCC cells in vitro and in vivo. [score:3]
These results suggest that miR-26a directly binds and negatively regulates ITGA5 mRNA stability. [score:3]
Using a combination of bioinformatic prediction and clinical sample analysis, we narrowed down ITGA5 as the putative target gene of miR-26a during anoikis (Figures 3, S1 and S2). [score:3]
Our data suggest that ITGA5 is targeted by miR-26a during anoikis. [score:3]
The data showed that overexpression of miR-26a significantly decreased the Gluc activity in the circulating system of nude mice, indicating that miR-26a potentially sensitizes anoikis of tumor cell in vivo (Figure 2E). [score:3]
The data show significant downregulation of miR-26a in venous metastatic cancer tissues compared to metastasis-free cancer tissues (Figure 1B). [score:3]
Taken together, these results support the notion that ITGA5 is a bona fide target gene of miR-26a in HCC cells. [score:3]
We predicted putative target genes of miR-26a by bioinformatics, and further analysed these genes in public clinical databases. [score:3]
de) were used to predict miR-26a targets. [score:3]
Figure 1(A) Relative expression levels of miR-26a (mean ± s. d. of three independent experiments) assessed by qRT-PCR in normal hepatocyte-derived cell line (L-02) and various HCC cell lines. [score:3]
Overexpression of miR-26a promotes HCC cells anoikis in vitro and in vivo. [score:3]
ITGA5 is a bona fide target gene of mir-26a. [score:3]
Potential miR-26a targeted genes associated with focal adhesion were analyzed and visualized by GenMAPP software (Version 2.1). [score:3]
qRT-PCR andting analyses revealed a significant (P < 0.05) inverse correlation between miR-26a and ITGA5 expression levels (Figure 3C, Figure 1A and Figure S3). [score:3]
Transient transfection of HEK-293 cells with the ITGA5-3′UTR construct along with miR-26a led to a significant decrease in reporter expression when compared with the control samples (Figure 3F). [score:2]
Expectedly, miR-26a overexpressed HCC cells performed a significantly decrease in Gluc activity compared with the control cells (Figure 2E). [score:2]
Our study suggests that miR-26a induces anoikis of HCC cells negatively regulating ITGA5. [score:2]
The results in Figure 1A show remarkably lower levels of miR-26a in HCC cells compared to an immortalized liver cell line, in agreement with a tumor suppressor role of miR-26a in HCC. [score:2]
Consequently, it is plausible that therapeutic strategies directed toward restoring miR-26a function would prove to be clinically useful in limiting metastatic progression in HCC. [score:2]
As shown in Figure 2B, overexpression of miR-26a clearly induced more cell death as compared with a control group. [score:2]
Next, we investigated whether the 3′UTR of ITGA5 is a direct target of miR-26a. [score:2]
Data from several large cohort studies showed that miR-26a is frequently silenced in HCC tissues and can act as a prognosis factor [23]. [score:1]
To do so, we cloned the 3′UTR of ITGA5 harboring the complementary sequence to miR-26a seed sequence in a reporter plasmid vector. [score:1]
The pLenti6.3-miR-26a vector was constructed using Gateway LR Clonase [II] Enzyme Mix (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. [score:1]
Men dell's group first reported that the administration of virus -mediated miR-26a potently eliminates tumor burden in a transgenic mouse mo del [24]. [score:1]
The seed sequence of miR-26a is complementary to the 3′UTR of ITGA5 and is highly conserved in six different species (Figure 3D). [score:1]
As expected, Annexin-V staining shows that reintroduction of ITGA5 counteract anoikis induced by miR-26a (Figure 5C). [score:1]
Silencing ITGA5 recapitulates the effects of miR-26a on anoikis in HCC cells in vitro and in vivo. [score:1]
To investigate the role of miR-26a in human HCC, we detected the expression levels of miR-26a in a panel of human HCC cell lines and a hepatocyte-derived immortal cell line by using qRT-PCR. [score:1]
The induction of caspase-3 activity and PARP cleavage further confirmed that miR-26a -induced cell death occurs mainly through cell-detachment induced apoptosis (Figure 2C, 2D). [score:1]
The biological effect and mechanism of miR-26a on tumor cell anoikis has not been clarified. [score:1]
Based on our discovery in vitro, we then asked whether miR-26a can affect anoikis of HCC cells in vivo. [score:1]
The mimics of miR-26a or miR-NC (20 pmol) along with firefly luciferase reporter gene construct (100ng) and a Renilla luciferase construct (5 ng; for normalization) were co -transfected per well. [score:1]
Therefore, we tested whether miR-26a-ITGA5 effects on anoikis acts through the Akt and ERK1/2 pathways. [score:1]
Silencing ITGA5 recapitulates the effects of miR-26a on anoikis in HCC cells in vitro and in vivoITGA5 is a member of the integrin family mediating cell-to-cell adhesion and can drive migration in tumor cells [32]. [score:1]
Although numerous evidence support the role of miR-26a as a critical antitumor molecule in HCC, the underlying mechanism remains unclear. [score:1]
The luciferase activity of the reporter vector containing a mutated 3′UTR of ITGA5 was unaffected by simultaneous transfection of miR-26a (Figure 3F). [score:1]
Synthesized RNA duplexes of scramble miRNA (Negetive Control, NC) and miR-26a were obtained from GenePharma (Shanghai, China). [score:1]
To construct a lentiviral vector expressing miR-26a, pre-miR-26a-2 and 150bp of flanking sequence was amplified with forward primer, 5′- ATCGTAAGGGTGGACAA-3′ and reverse primer, 5′-AGCTCTCAACCCCTGCA-3′. [score:1]
In parallel, we mutated the 3′UTR of ITGA5 complementary to the miR-26a seed sequence in the same reporter plasmid (Figure 3E). [score:1]
Analyses of two normalized GEO datasets (GSE14520 & GSE6857) show that only ITGA5 mRNA levels were inversely correlated with miR-26a (Figure 3B, Figure S2). [score:1]
Provided that anoikis is a major barrier of tumor cell metastasis, our study identified a novel and crucial role of miR-26a during HCC pathogenicity. [score:1]
The fragment was cloned into pENTR [TM]3C vector using Kpn [I]and EcoR [V] digestion, and inserted into pLenti6.3 vector as pLenti6.3-miR-26a described before. [score:1]
[1 to 20 of 87 sentences]
4
[+] score: 248
Other miRNAs from this paper: hsa-mir-26a-2
To elucidate the role of miR-26a in regulating the osteogenic differentiation of hADSCs, a total of three lentiviral expression systems were constructed: a lentiviral vector overexpressing miR-26a (miR-26a); a lentiviral vector expressing the complementary sequence of mature miR-26a (miR-26a inhibitor); and a lentiviral vector without any insertions of expression sequences (miR-NC), which was used as control. [score:12]
The overexpression of miR-26a significantly up-regulated the mRNA and protein expression of osteogenic-specific markers and also increased ALP activity and the promotion of extracellular matrix (ECM) mineralization; the knockdown of miR-26a attenuated these processes. [score:9]
To test the regulatory pattern of C/EBPα on miR-26a expression in this study, a C/EBPα expressing vector was transfected into hADSCs and our data showed that miR-26a, along with the expression level of CTDSPL, were dramatically elevated by C/EBPα, suggesting that miR-26a was co-transcribed with CTDSPL. [score:8]
The lentiviral expression vector expressing the reverse complementary sequence of hsa-miR-26a was termed miR-26a inhibitor. [score:7]
Combined with the results that miR-26a directly targets GSK3β by binding to the 3′UTR, we speculated that miR-26a might regulate osteogenic differentiation by inhibiting GSK3β in hADSCs. [score:7]
To further validate whether miR-26a directly interacted with GSK3β 3′UTR and subsequently interfered with the translation process, we searched miRanda and TargetScan, where a more negative score indicates a greater likelihood of being a direct binding site of miR-26a. [score:7]
Taken together, our data showed that miR-26a suppressed the protein levels of GSK3β, whereas the knockdown of miR-26a increased GSK3β protein expression. [score:6]
The primers used for analysing the precipitated DNA are listed in Table 2. To predict the target genes of miR-26a during the osteoblast differentiation of hADSCs, we selected scientifically sanctioned miRNA target prediction databases: TargetScan (www. [score:6]
Overall, these data suggested that the overexpression of miR-26a promoted the osteogenic differentiation of hADSCs whereas the knockdown of miR-26a repressed it, indicating that miR-26a was a positive regulator for the osteogenesis of hADSCs. [score:5]
Data from each time point were normalized to the miR-NC group at day 0. (H) ALP and ARS staining revealed that the exogenous overexpression of miR-26a increased intracellular ALP levels and mineralized the extracellular matrix, whereas the miR-26a inhibitor reduced these levels. [score:5]
qPCR analyses showed that intracellular miR-26a was remarkably elevated by the transduction of miR-26a, whereas its expression was reduced to less than 30% by the transduction of miR-26a inhibitor (Fig. 1B,C). [score:5]
The lentiviral expression vector expressing hsa-miR-26a was termed miR-26a. [score:5]
As shown in Supplementary Fig. S1A online, miR-26a expression was gradually up-regulated in hADSCs cultured in osteogenic medium compared with those cultured in normal medium. [score:5]
To test our hypothesis, hADSCs were transduced with miR-26a, miR-26a inhibitor or miR-NC, western blot and qPCR results demonstrated that miR-26a repressed GSK3β protein levels, but did not affect the mRNA expression of GSK3β, indicating that miR-26a repressed GSK3β at a post-transcriptional level. [score:5]
Evidence has indicated that miR-26a is up-regulated in MSCs during osteogenic differentiation, suggesting that miR-26a could be involved in the regulation of osteogenic differentiation 21 22. [score:5]
Therefore, we hypothesized that miR-26a might also directly target GSK3β in hADSCs to regulate the osteogenic differentiation process. [score:5]
Then, miR-26a -overexpressing plasmid (miR-26a) or empty plasmid (miR-NC) was individually co -transfected with GSK3β 3′UTR-wt or GSK3β 3′UTR-mut, and the renilla luciferase plasmid (pRL-TK) was used to normalise the expression. [score:5]
As shown in Supplementary Fig. S1B online, the co-transfection of miR-26a and GSK3β 3′UTR-full-wt significantly repressed the luciferase expression, whereas the co-transfection of miR-26a and GSK3β 3′UTR-full-mut showed little effect on luciferase expression. [score:5]
Our data indicated that the overexpression of miR-26a promoted osteogenic differentiation, whereas the knockdown of miR-26a repressed osteogenesis in hADSCs, suggesting that miR-26a acts as a positive regulator of hADSC osteogenic differentiation. [score:5]
Our qPCR results showed that the expression levels of miR-26a and CTDSPL were both greatly promoted by the overexpression of C/EBPα (Fig. 6A,B), suggesting that miR-26a is co-transcribed with CTDSPL. [score:5]
Among these binding sites, position 4636–4643 had the most negative score (−0.7538 in miRanda, and −0.247 in TargetScan), indicating that miR-26a could directly bind to this site. [score:4]
These findings suggested that GSK3β was a direct target of miR-26a. [score:4]
Our qPCR analyses detected no significant changes in the levels of GSK3β mRNA (Fig. 2B), suggesting that miR-26a regulated the expression of GSK3β at the post-transcriptional level. [score:4]
GSK3β is a direct target of miR-26a. [score:4]
To investigate the regulatory pattern of C/EBPα on miR-26a expression in hADSCs, a C/EBPα overexpression plasmid (p-C/EBPα) was constructed and then transfected into hADSCs. [score:4]
Furthermore, miR-26a repressed the translation of GSK3β by directly binding to position 4636–4643 of the GSK3β 3′UTR. [score:4]
Above all, our data suggested that C/EBPα transcriptionally activates the expression of miR-26a in hADSCs and that this activation was mediated through the direct binding of C/EBPα to the CTDSPL promoter region. [score:4]
In the present study, miR-26a was shown to be up-regulated, in a time -dependent manner, in hADSCs during osteogenic differentiation, suggesting that miR-26a might participate in the osteogenic differentiation process of hADSCs. [score:4]
Next, we performed qPCR 7 days after the transduction, which revealed that the overexpression of miR-26a resulted in an increase in the mRNA expression levels of several osteogenic marker genes, such as Ocn, BSP, Runx2 and Osx, to at least 1.5-fold compared to miR-NC (Fig. 1D). [score:4]
MiR-26a was shown to suppress GSK3β by directly binding to the 3′UTR of its mRNA, and GSK3β was demonstrated to negatively regulate the osteogenesis of hADSCs. [score:4]
Taken together, these findings indicated that C/EBPα transcriptionally activates miR-26a expression by directly binding to the CTDSPL promoter region. [score:4]
Taken together, our data demonstrated a novel feedback regulatory loop consisting of miR-26a, GSK3β and C/EBPα whose function might contribute to the regulation of hADSC osteogenesis, and our findings will help expand our knowledge about the precise and complex regulatory network controlling cell differentiation. [score:4]
Our data demonstrated that the overexpression of miR-26a enhanced hADSC osteogenesis, whereas osteogenesis was repressed by miR-26a knockdown. [score:4]
Finally, C/EBPα was demonstrated to transcriptionally regulate the expression of miR-26a by physically binding to the CTDSPL promoter region (Fig. 7). [score:4]
To test our hypothesis of whether, hADSCs were transduced with miR-26a, miR-26a inhibitor or miR-NC, and the results of western blot showed that the protein levels of GSK3β was repressed by miR-26a but promoted by miR-26a inhibitor compared to miR-NC (Fig. 2A). [score:4]
Furthermore, western blot analyses was performed 7 days after transduction to detect the protein levels of genes related to osteogenesis, and the protein levels of Ocn, BSP and Runx2 were increased in miR-26a-transduced hADSCs while decreased in miR-26a inhibitor-transduced hADSCs (Fig. 1I). [score:3]
As shown in Fig. 1H, miR-26a-transduced hADSCs exhibited both increased ALP activity and more mineralized ECM, whereas the miR-26a inhibitor led to reduction of both. [score:3]
To investigate the expression pattern of endogenous miR-26a during the osteogenic differentiation process, hADSCs were treated with either osteogenic medium or normal medium, and the expression levels of miR-26a were detected at each time point by qPCR. [score:3]
A total of 0.4 μg of pGL3-control (Promega) plasmid containing either the wild type or the mutant miR-26a binding site, 0.3 μg of pRL-TK (Promega) plasmid containing the renilla luciferase reporter gene, and 0.3 μg of miR-26a expressing vector were co -transfected into 293T cells using the Lipofectamine 2000 Reagent (Invitrogen). [score:3]
We further revealed that miR-26a interfered with GSK3β by directly binding to the 3′UTR of its mRNA and that GSK3β served as a negative regulator of osteogenesis in hADSCs. [score:3]
In contrast, the knockdown of miR-26a by the transduction of miR-26a inhibitor decreased those same mRNA levels by as much as 50% compared to miR-NC (Fig. 1E). [score:3]
Intracellular miR-26a levels were greatly increased by the lentiviral transduction of miR-26a (B) and were remarkably decreased by a miR-26a inhibitor in a time -dependent manner (C). [score:3]
Collectively, our data suggested that GSK3β was one of the target genes of miR-26a in hADSCs and that miR-26a repressed GSK3β by specifically binding to position 4636–4643 of the GSK3β 3′UTR. [score:3]
C/EBPα was found to transcriptionally activate the expression of miR-26a by physically binding to the CTDSPL promoter region. [score:3]
How to cite this article: Wang, Z. et al. A regulatory loop containing miR-26a, GSK3β and C/EBPa regulates the osteogenesis of human adipose-derived mesenchymal stem cells. [score:3]
C/EBPα regulates miR-26a by directly binding to its promoter region. [score:3]
We found out several miR-26a putative binding sites whose score ranges from −0.0022 to −0.7538 (miRanda) and −0.120 to −0.247 (TargetScan). [score:3]
Luciferase assay revealed that co-transfection of miR-26a and luciferase reporter plasmid containing the wild-type binding site potently repressed luciferase expression levels, suggesting that position 4636–4643 of GSK3β 3′UTR was one of the direct binding sites of miR-26a. [score:3]
Therefore, we tested whether miR-26a is regulated by C/EBPα in hADSCs and explored the precise regulatory mechanism using luciferase reporter assays and chromatin immunoprecipitation (ChIP). [score:2]
C/EBPα reverse transcriptionally regulated miR-26a by physically binding to the CTDSPL promoter region. [score:2]
miR-26a was demonstrated to positively regulate the osteogenesis of hADSCs whereas GSK3β repressed the osteogenic process. [score:2]
Luciferase assays indicated that the co-transfection of miR-26a and GSK3β 3′UTR-full-wt significantly repressed luciferase expression. [score:2]
Luciferase assays showed that the co-transfection of miR-26a and GSK3β 3′UTR-wt dramatically decreased the luciferase activity compared with the other groups (Fig. 2E), indicating that position 4636–4643 of the 3′UTR of GSK3β was a direct target of miR-26a. [score:2]
Previous studies have revealed that miR-26a is involved in the regulation of human airway smooth muscle cell hypertrophy and the promotion of hypoxic rat neonatal cardiomyocytes apoptosis through the repression of glycogen synthase kinase 3β (GSK3β) 39 40. [score:2]
To elucidate the effects of miR-26a on the regulation of osteogenesis in hADSCs, we performed gain- and loss-of function analyses. [score:2]
The schematic diagram represents the regulatory loop containing miR-26a, GSK3β and C/EBPα. [score:2]
In summary, our data demonstrated that miR-26a is a positive regulator of the osteogenesis of hADSCs. [score:2]
ALP and alizarin red s (ARS) staining were also performed 14 days after transduction to generally observe miR-26a’s effects on ALP activity and mineralization of ECM. [score:1]
Furthermore, to clarify whether the protein repressive effect of miR-26a on GSK3β was mediated by the specific binding of miR-26a to position 4636–4643 of GSK3β 3′UTR and to exclude that secondary structures of the full-length 3′UTR hamper the recognition of the particular binding site, we synthesized the full-length of the 3′UTR of GSK3β carrying either the wild-type or mutant sequence of position 4636–4643. [score:1]
According to the Ensembl Genome database, the miR-26a gene is located within the intron of the CTD small phosphatase-like protein (CTDSPL) gene. [score:1]
To generate the luciferase reporter vector, a 199-bp fragment of GSK3β (NM_001146156) 3′UTR containing the predicted miR-26a binding site (position 4636–4643) and its mutant sequence were synthesized by Genechem and cloned into pGL3-control vector (Promega (Beijing) Biotech Co. [score:1]
miR-26a promoted the osteogenesis of hADSCs. [score:1]
Important osteogenic marker alkaline phosphatase (ALP) activity was measured by a quantitative ALP assay and showed that the overexpression of miR-26a promoted ALP activity; ALP activity was decreased by the knockdown of miR-26a. [score:1]
To obtain a full picture of the post-transcriptionally repressive effects of miR-26a on GSK3β and to exclude the possibility that secondary structures of the full-length 3′-UTR were hampering the recognition of the particular binding site, we also synthesized the full-length 3′UTR of GSK3β carrying either the wild-type or mutant sequences of position 4636–4643. [score:1]
First, according to the Ensembl genome database, miR-26a is located at chromosome 3 and overlaps with CTD small phosphatase-like protein (CTDSPL). [score:1]
miR-26a promotes the osteogenesis of hADSCs. [score:1]
[1 to 20 of 66 sentences]
5
[+] score: 218
Other miRNAs from this paper: hsa-mir-26a-2, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3
MiR-26a-5p is upregulated in preeclampsia and targets podocyte VEGF-A. The functional and ultrastructural correlates of glomerular changes seen after miR-26a-5p overexpression in zebrafish with proteinuria, edema, glomerular endotheliosis and podocyte effacement highly resembled the finding in human preeclampsia. [score:8]
Interestingly, overexpression of miR-26a-5p in cultured human podocytes resulted in a 5-fold downregulation of VEGF-A mRNA expression compared to miR control (miR-CTRL) transfected cells (Fig.   1C). [score:7]
However, we also could demonstrate that podocytes express miR-26a-5p and we could detect a downregulation of VEGF-A due to miR-26a-5p in cultured human podocytes. [score:6]
Chai ZT microRNA-26a suppresses recruitment of macrophages by down -regulating macrophage colony-stimulating factor expression through the PI3K/Akt pathway in hepatocellular carcinomaJ. [score:6]
Chai and co-workers detected that expression of VEGF-A was inversely correlated with miR-26a-5p expression in hepatocellular carcinoma and that miR-26a-5p modulated angiogenesis of hepatocellular carcinoma through the PIK3C2α/Akt/HIF-1α/VEGFA pathway [21]. [score:5]
These data indicate that the effect of miR-26a-5p on modulating VEGF-A expression is again indirectly regulated via the PIK3C2α/Akt/HIF-1α/VEGFA pathway as previously described in HCC 21– 23. [score:5]
Thus, miR-26a-5p has a regulatory function on the local VEGF-A in the glomerulus, where podocytes are the major source of VEGF-A. Moreover, MiR-26a-5p expression also effected the actin cytoskeleton of cultured podocytes directly (Fig.   1F). [score:5]
As miR-26a-5p was increased in our pilot study in urines from patients with preeclampsia and podocyturia, this miR might have the potential to serve as a promising non-invasive biomarker or potential therapeutic target to antagonize the reduction of VEGF-levels in the disease. [score:5]
We also used U6 snRNA as an endogenous normalization for our urinary miR data and confirmed upregulation of miR-26a-5p in preeclampsia (Fig.   7C). [score:4]
We looked for miR-26a-5p expression in urine samples from preeclamptic patients with proteinuria and podocyturia and compared the expression levels with those in urine samples from healthy on-pregnant controls as well as healthy pregnant controls in a small pilot study. [score:4]
By generating fold changes in urinary miR-26a-5p expression in patients with preeclampsia compared to non-pregnant and pregnant healthy controls we could show that miR-26a-5p expression was significantly elevated in urines from preeclamptic women with ongoing podocyte damage (Fig.   7B). [score:4]
Figure  7D summarizes the pathway how miR-26a-5p downregulates VEGF-A though PIK3C2α. [score:4]
In another context, miR-26a-5p has also been described to regulate VEGF-A expression in hepatocellular carcinoma [21]. [score:4]
Downregulation of VEGF-A protein 72 h after transfection with a miR-26a-5p mimic could be demonstrated with western blot technique (Fig.   1D,E). [score:4]
Only 16% of zebrafish showed P3 or P4 edema after a co-injection of the miR-26a-5p mimic together with the Vegf-Aa protein, indicating that vegf-Aa downregulation was the causative factor for inducing proteinuria in 48 hpf developed zebrafish larvae as well (Fig.   5B,C; n = 80). [score:4]
The analysis with a zebrafish specific vegf-Aa antibody confirmed that Vegf-Aa protein was downregulated after vegf-Aa-MO and miR-26a-5p mimic injection (Fig.   4A). [score:4]
With the cloning of wild-type human PIK3C2α 3′UTR to a luciferase reporter construct, we could emphasize that miR-26a-5p directly targets PIK3C2α 3′UTR (supplementary Fig.   1D). [score:4]
To rule out impairments in angiogenesis or glomerular development as potential confounder in our zebrafish mo del, we overexpressed miR-26a-5p at a time when angiogenesis and glomerular function is considered largely established. [score:3]
PIK3C2α is an upstream protein in the VEGF-A signaling pathway and the effect of miR-26a-5p on modulating VEGF-A expression through the PIK3C2α/Akt/HIF-1α/VEGFA pathway was previously described and is well documented 21– 23. [score:3]
We demonstrated that exogenous miR-26a-5p decreases VEGF-A expression in cultured human podocytes. [score:3]
Still, urinary miR-26a-5p expression in preeclampsia has to be confirmed larger patient cohorts. [score:3]
MiR-26a-5p was upregulated in placentas and plasma from preeclamptic women [20]. [score:3]
Endogenous normalization methods revealed that miR-26a-5p was upregulated in urine samples from patients with preeclampsia compared to healthy non-pregnant and healthy pregnant controls. [score:3]
Therefore, it is conceivable that local overexpression of miR-26a-5p by podocytes together with circulating miR-26a-5p derived from the placenta contribute to the reduced glomerular VEGF-A level in preeclampsia. [score:3]
Therefore, we conclude that regulation of VEGF-A through miR-26a-5p is most likely indirect via PIK3C2α. [score:3]
We examined the expression of miR-26a-5p in cultured human glomerular endothelial cells (h. GECs) and human podocytes (h. PODs). [score:3]
Phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing alpha polypeptide (PIK3C2α) is another potential target of miR-26a-5p with even two binding sites. [score:3]
Figure 5Vegf-Aa knockdown by miR-26a-5p causes proteinuria and edema in afore healthy zebrafish (A): Pictures of tail vessels (a), glomeruli fusing at zebrafish midline (b) and eye vessel plexus (c) of 48 h old zebrafish shows proper vascular development as well as glomerular fusion. [score:3]
Overexpression of miR-26a-5p in zebrafish by microinjection of a specific miR-26a-5p mimic was sufficient to resemble glomerular changes of preeclampsia [1] with proteinuria, edema, glomerular endotheliosis with endothelial cell swelling, loss of glomerular endothelial fenestration and podocyte foot process effacement. [score:3]
Therefore, we hypothesize that miR-26a-5p is involved in glomerular pathology seen in preeclampsia and base our observation on the following lines of evidence: In the glomerulus, miR-26a-5p is predominantly expressed by podocytes 44, 45. [score:3]
Using target prediction tools (FindTar3) we first identified the potential binding site of miR-26a-5p in the 3′UTR region of VEGF-A (supplementary Fig.   1A). [score:3]
We used the zebrafish mo del to study functional and ultrastructural abnormalities of the glomerular filtration barrier due to miR-26a-5p overexpression. [score:3]
MiR-26a-5p was described to be upregulated in plasma and placental tissues of women with severe preeclampsia in another study [60]. [score:3]
Overexpression of miR-26a-5p by injection of a specific miR-26a-5p mimic at the one to four cell stage was still detectable at 120 hpf. [score:3]
To validate VEGF-A as a target of miR-26a-5p we transfected cultured human podocytes with a miR-26a-5p mimic. [score:3]
Impairments in tail vessel sprouting after vegf-Aa knockdown by MO resembled those after miR-26a-5p mimic injection (Fig.   4C). [score:2]
MiR-26a-5p targets VEGF-A in cultured human podocytes trough PIK3C2α. [score:2]
We could demonstrate that the miR-26a-5p mimic was still detectable at 120 hpf and the expression levels of miR-26a-5p were 4 times higher compared to control at that time (Fig.   2C). [score:2]
Vegf-Aa knockdown by miR-26a-5p causes proteinuria and edema in 48 hpf developed zebrafish. [score:2]
Figure 3Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic causes loss of plasma proteins in zebrafish larvae. [score:2]
In this study we wanted to investigate whether miR-26a-5p has a direct impact on glomerular VEGF expression and leads to impairment of the filtration barrier function. [score:2]
Even though there is a predicted direct binding side of miR-26a-5p to VEGF-A a reporter luciferase assay for the functional assessment of this interaction could not prove a direct binding. [score:2]
Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic leads to glomerular endotheliosis and podocyte effacement that can be rescued by recombinant zebrafish Vegf-Aa protein. [score:2]
After transfection of cultured human podocytes with a miR-26a-5p mimic PIK3C2α mRNA was down regulated (Fig.   1H). [score:2]
Figure 6 Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic causes glomerular endotheliosis and podocyte effacement that can be rescued by Vegf-Aa protein. [score:2]
Figure 2Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic leads to edema and loss of plasma proteins. [score:2]
A recombinant zebrafish Vegf-Aa protein was able to rescue the phenotype caused by vegf-Aa-MO or miR-26a-5p mimic but was not able to significantly rescue vegf-Ab knockdown. [score:2]
Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic induces loss of plasma proteins in zebrafish. [score:2]
Figure 4Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic cause impairments in intersegmental tail vessel sprouting. [score:2]
Vegf-A knockdown by injection of either a vegf-Aa-MO, a vegf-Ab-MO or a miR-26a-5p mimic at one to four cell stages caused a significant loss of plasma proteins at 96 hpf. [score:2]
Transmission electron microscopy pictures showing glomerular endotheliosis and podocyte effacement vegf-Aa knockdown by injection of a vegf-Aa morpholino (vegf-Aa-MO) or a miR-26a-5p mimic (miR-26a-5p). [score:2]
Impaired intersegmental tail vessel sprouting after vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic in zebrafish. [score:2]
The above described effects on the zebrafish vasculature could also indicate developmental defects in vegf-Aa-MO and miR-26a-5p mimic injected zebrafish. [score:2]
MiR-26a-5p is expressed in urine samples from preeclamptic patients with podocyturia. [score:2]
Next, we looked for miR-26a-5p expression in urine samples from patients with preeclampsia compared to healthy non-pregnant women and healthy pregnant controls. [score:2]
Vegf-Aa knockdown by either injection of a vegf-Aa-MO or a miR-26a-5p mimic led to a swollen endothelium with loss of glomerular endothelial cell-specific fenestration and podocyte effacement. [score:2]
Therefore, miR-26a-5p detected in the urine from patients with preeclampsia might have been derived from the placenta, been delivered to the circulation and been filtered into the urine in the glomerulus. [score:1]
An injection of a miR-26a-5p mimic in the c. v. of the zebrafish at 48 hpf caused proteinuria and edema which could be rescued if the miR-26a-5p mimic was co -injected with a recombinant zebrafish Vegf-Aa protein. [score:1]
Zebrafish were injected with a control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO), a recombinant zebrafish Vegf-Aa protein (Vegf-Aa protein), a miR-26a-5p mimic (miR-26a-5p), a control miR mimic (miR-CTRL) or a combination of vegf-Aa-MO and recombinant Vegf-Aa protein (vegf-Aa-MO + Vegf-Aa) a. e a combination of miR-26a mimic and zebrafish Vegf-Aa protein (miR-26a-5p + Vegf-Aa) as indicated at one to four cell stages or at 48 hpf (c. v. miR-26a, c. v. miR-26a-5p + Vegf-Aa). [score:1]
Again, these findings could be rescued if the miR-26a-5p mimic was co -injected with a recombinant zebrafish Vegf-Aa protein in the c. v. at 48 hpf. [score:1]
To accomplish this we performed an injection of a miR-26a-5p mimic in the cardinal vein (c. v. ) of anesthetized zebrafish at 48 hours post fertilization (hpf). [score:1]
63% of vegf-Aa-MO and 65% of miR-26a-5p mimic injected fish did not develop intersegmental tail vessels. [score:1]
Furthermore, urinary miR-26a-5p was detectable together with podocyturia in urines from preeclamptic women with ongoing podocyte damage. [score:1]
Seven days differentiated cultured human podocytes were transfected with 100 pM miR-26a-5p mimic/miR-CTRL for 4 h using Lipofectamin and Opti-MEM Medium (Thermo Fisher scientific, Waltham, MA) according to manufactures protocol. [score:1]
Injection of a Vegf-Aa specific morpholino or a miR-26a-5p mimic leads to generalized edema in zebrafish. [score:1]
Zebrafish Vegf-Aa protein was able to ameliorate glomerular damage induced by vegf-Aa-MO and miR-26a-5p mimic (Fig.   6). [score:1]
The edemous phenotype was categorized in 4 groups: P1 = no edema, P2 = mild edema, P3 = severe edema, P4 = very severe edema, Dead fish are those found dead between 72 hpf and 96 hpf; CTRL-MO n = 15, vegf-Aa-MO n = 20, vegf-Aa-MO + Vegf-Aa n = 21, vegf-Ab-MO n = 16, vegf-Ab-MO + Vegf-Aa n = 16, miR-CTRL n = 16, miR-26a-5p n = 14, miR-26a-5p + Vegf-Aa n = 24, WT + Vegf-Aa n = 17, WT n = 18, total n = 177. [score:1]
When we closely examined the tail vessels we could detect significant blood pooling in zebrafish injected with the vegf-Aa-MO or miR-26a-5p mimic. [score:1]
Arrow heads illustrate defects in sprouting of intersegmental vessel in vegf-Aa-MO and miR-26a-5p mimic injected fish. [score:1]
From our data in zebrafish it is tempting to posit that miR-26a-5p is involved in glomerular pathology seen in preeclampsia. [score:1]
Zebrafish were injected with either a recombinant zebrafish Vegf-Aa protein (Vegf-Aa protein), a control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO), a control miR mimic (miR-CTRL) or a miR-26a-5p mimic (miR-26a) at the one to four cell stages. [score:1]
At this time the tail vasculature, glomerular fusion and retinal vessel formation was already formed; c. v. miR-CTRL n = 10, c. v. miR-26a-5p n = 17, miR-26a-5p + Vegf-Aa n = 13, WT + Vegf-Aa n = 8, total n = 48. [score:1]
We used the mirVana® miRNA mimic has-miR-26a-5p (miR-26a-5p mimic, Life Technologies, Carlsbad, CA, Catalog # 4464066) and mirVana® miRNA mimic negative control #1 (miR-CTRL mimic, Life Technologies, Carlsbad, CA Catalog #4464058) for cell culture experiments in human podocytes. [score:1]
A recombinant zebrafish Vegf-Aa could reduce edema formation when it was co -injected with the vegf-Aa-MO or the miR-26a-5p mimic. [score:1]
Transfection of miR-26a-5p in cultured human podocytes. [score:1]
a) Survival of zebrafish injected with a vegf-Aa morpholino (vegf-Aa-MO) in black versus co-injection of a vegf-Aa morpholino and a Vegf-Aa protein (vegf-Aa-MO + Vegf-Aa protein) in red; n = 64. b) Survival of zebrafish injected with a vegf-Ab morpholino (vegf-Ab-MO) in black versus co-injection of a vegf-Ab morpholino and a Vegf-Aa protein (vegf-Ab-MO + Vegf-Aa protein) in red; n = 62. c) Survival of zebrafish injected with a miR-26a-5p mimic (miR-26a-5p) in black versus co-injection of a miR-26a-5p mimic and a Vegf-Aa protein (miR-26a-5p + Vegf-Aa protein) in red; n = 69. [score:1]
Co-injection of the recombinant zebrafish Vegf-Aa was able to rescue the loss of plasma proteins caused by vegf-Aa-MO and miR-26a-5p mimic but was not able to significantly decrease the proteinuria caused by vegf-Ab-MO (Fig.   3B; n = 177). [score:1]
Interestingly, co-injection of the vegf-Aa-MO or the miR-26a-5p mimic with recombinant Vegf-Aa protein significantly increased the survival of zebrafish (62% survival in the vegf-Aa-MO group versus 77% survival in the vegf-Aa-MO + Vegf-A protein group and 40% survival in the miR-26a-5p mimic group versus 94% in the miR-26a-5p mimic + Vegf-A protein group at 120 hpf). [score:1]
Cultured human podocytes were grown on cover slides and transfected with miR-26a-5p mimic or CTRL -mimic as described above. [score:1]
These impairments could be ameliorated by a co-injection of a zebrafish Vegf-Aa protein (64% normal intersegmental vessel sprouting in vegf-Aa-MO/Vegf-Aa protein co -injected zebrafish and 53% normal intersegmental vessel sprouting in miR-26a-5p -mimic/Vegf-Aa protein co -injected zebrafish) (Fig.   4C,D). [score:1]
MiR-26a-5p mimic (30 nM, 50 nM and 100 nM), pmiR-report-3′-UTR and beta-Gal normalizing plasmid (20 ng) were transfected to HEK293 cells. [score:1]
We controlled for successful transfection of the miR mimic by performing TaqMan qPCR for miR-26a-5p in the transfected cells 72 h after transfection (Fig.   1B). [score:1]
Zebrafish were either injected with control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO), a vegf-Ab morpholino (vegf-Ab-MO), a control miR mimic (miR-CTRL) or a miR-26a-5p mimic (miR-26a-5p) alone (−) or as co-injection with a recombinant zebrafish Vegf-Aa protein (Vegf-Aa) (+) at one to four cell stages. [score:1]
Full-length blots are presented in supplementary Fig.   3. (B) Phenotype pictures of zebrafish show blood pooling in tail region (arrow heads) in zebrafish that were injected with a vegf-Aa morpholino (vegf-Aa-MO) or a miR-26a-5p mimic (miR-26a-5p) were as control injected fish (CTRL-MO and miR-CTRL) appeared normal. [score:1]
Indeed, we detected impairments in intersegmental tail vessel sprouting when we injected a vegf-Aa-MO or miR-26a-5p mimic in zebrafish at the one to four cell stages. [score:1]
A control miR mimic (miR-CTRL), a miR-26a-5p mimic (miR-26a-5p) or the combination of miR-26a-5p and Vegf-Aa protein were injected in the cardinal vein at 48 hpf. [score:1]
Injection of miR mimics (mirVana® miRNA mimic has-miR-26a-5p (miR-26a-5p mimic, Life Technologies, Carlsbad, CA, Catalog # 4464066) and mirVana® miRNA mimic negative control #1 (miR-CTRL mimic, Life Technologies, Carlsbad, CA Catalog #4464058) in a concentration of 25 µM was done by microinjection in zebrafish eggs at one to two cell stages or in the cardinal vein of the fish at 48 hpf as previously described [25]. [score:1]
Zebrafish were injected with either a control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO) a miR-26a-5p mimic (miR-26a-5p), a control miR mimic (miR-CTRL) alone (−) or together with a recombinant zebrafish Vegf-Aa protein (Vegf-Aa) (+) at the one to four cell stages. [score:1]
To confirm that Vegf-Aa protein level was reduced in the zebrafish after both vegf-Aa-MO and miR-26a-5p mimic injection, we performed western blot analysis of whole zebrafish larvae (10 per group) at 96 hpf. [score:1]
Transfection of cultured human podocytes with a miR-26a-5p mimic caused a reorganization of the actin cytoskeleton that was time dependent (Fig.   1F). [score:1]
However, luciferase assay revealed only a marginal effect and did not prove a direct binding of miR-26a-5p to VEGF-A in two different concentration used for miR-26a-5p mimic transfection (supplementary Fig.   1B,C). [score:1]
Only 3% of vegf-Aa-MO and 7% of miR-26a-5p mimic injected fish showed complete intersegmental tail vessel sprouting. [score:1]
Similar to earlier experiments, injection of a miR-26a-5p mimic in the zebrafish larvae at this later time point led to loss of plasma proteins and edemous phenotype. [score:1]
Higher levels of miR-26a-5p were previously detected in placentas and plasma from preeclamptic women [20]. [score:1]
Levels of miR-26a-5p were significantly higher in cultured human podocytes (Fig.   1A). [score:1]
[1 to 20 of 95 sentences]
6
[+] score: 194
Other miRNAs from this paper: hsa-mir-26b, hsa-mir-26a-2
By upregulating and downregulating miR-26a in osteosarcoma cells, we confirmed that miR-26a could inhibit the abilities of in vitro proliferation and suppress in vivo tumor growth. [score:11]
Taken together, the current study provided novel evidence that miR-26a is significantly downregulated in osteosarcoma clinical specimens and appears to function as a tumor suppressor in osteosarcoma through the regulation of IGF-1 expression and cell proliferation. [score:9]
Moreover, we revealed that insulin-like growth factor 1 (IGF-1) is a target of miR-26a, and miR-26a exerted its tumor-suppressor function, at least in part, by inhibiting IGF-1 expression. [score:9]
To determine whether through targeting IGF-1, we found that IGF-1 overexpression could rescue growth inhibition of miR-26a. [score:7]
Overexpression of miR-26a inhibited cell proliferation, whereas inhibition of miR-26a promoted cell growth (Figure 2b and c). [score:7]
The above results prompted us to examine whether miR-26a suppresses osteosarcoma growth by inhibiting IGF-1 expression. [score:7]
[20] Breast cancer also exhibits decreased expression of miR-26a and overexpression of this miRNA results in inhibition of tumor growth and metastasis. [score:7]
We found that the overexpression of miR-26a in MG-63 cells significantly suppressed tumor growth in nude mice (Figure 3b–d). [score:5]
miR-26a inhibits cell proliferation by targeting IGF-1 in osteosarcoma cells. [score:5]
In miR-26a -expressing cells, overexpression of IGF-1 rescued growth defects of miR-26a (Figure 4e and f). [score:5]
Moreover, there was an inverse correlation between miR-26a expression and IGF-1 expression in osteosarcoma tissues. [score:5]
There was an inverse correlation between miR-26a expression and IGF1 expression in osteosarcoma tissues (Figure 4f) Recent studies have revealed a critical role for miRNAs in tumor initiation and progression, including in osteosarcoma. [score:5]
There was an inverse correlation between miR-26a expression and IGF1 expression in osteosarcoma tissues (Figure 4f) To investigate the role of miR-26a in human osteosarcoma, we first examined miR-26a expression in n = 32 pairs of osteosarcoma tissues and pair-matched adjacent noncancerous tissues using quantitative qRT-PCR. [score:5]
Furthermore, miR-26a inhibitors transfection increased its mRNA and protein levels, further indicating that IGF-1 is a target of miR-26a in osteosarcoma cells. [score:5]
In agreement, miR-26a overexpression significantly reduced both mRNA and protein expression for IGF-1 in MG-63 cells (Figure 4c and d). [score:5]
These results suggest that miR-26a inhibits osteosarcoma cell proliferation partly by targeting IGF1. [score:5]
27, 28 In our studies, we confirmed that IGF-1 was a direct target of miR-26a in osteosarcoma cells. [score:4]
miR-26a is downregulated in osteosarcoma. [score:4]
To verify whether IGF-1 is a direct target of miR-26a, we cloned the wild-type 3’-UTR or the mutant (lacking the 7-bp seed sequence) into a luciferase reporter vector. [score:4]
Conversely, cotransfection of miR-26a mimics with the mutated form of the 3’-UTR resulted in no significant change in luciferase activity (Figure 4b), suggesting miR-26a directly targets the IGF-1 3’-UTR. [score:4]
Furthermore, we also identified IGF-1 as a novel and direct target of miR-26a. [score:4]
[15] Although miR-26a was found to be downregulated in osteosarcoma previously, [16] its biological function and precise mechanism in osteosarcoma remain largely elusive. [score:4]
In this study, we confirmed the downregulation of miR-26a in osteosarcoma tissues. [score:4]
Using both gain- and loss-of-function analyses, we further revealed that miR-26a suppressed osteosarcoma cell proliferation in vitro and in vivo. [score:3]
Yielding mutant constructs, mutations were introduced in potential miR-26a binding sites using the QuikChange site-directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). [score:3]
[15] These controversial results suggested that the role of miR-26a was possibly tumor-specific and highly dependent on its targets in different cancer cells. [score:3]
[17–19] In the present study, we determined that the level of miR-26a expression was significantly lower in osteosarcomas than that in adjacent nontumor tissue. [score:3]
[7–10] There are still controversies about the roles of miR-26a in human malignancies, as it is a tumor suppressor in breast cancer, [11] gastric cancer, [12] and hepatocellular carcinoma, 13, 14 but is an oncogene in glioma [14] and cholangiocarcinoma. [score:3]
miR-26a suppresses osteosarcoma cell proliferation. [score:3]
Various studies have shown that PTEN, [21] EZH2, 22, 23 SMAD1, [24] CDK6, and cyclin E1 [25] are potential downstream target genes of miR-26. [score:3]
Our findings suggest that miR-26a has a suppressor role in osteosarcoma tumorigenesis. [score:3]
Using in silico prediction programs, we identified IGF-1 as a potential target for miR-26a. [score:3]
For example, miR-26a is decreased in hepatocellular carcinoma (HCC) and could suppress tumor angiogenesis of HCC through hepatocyte growth factor -cMet signalling. [score:3]
For this purpose, we transfected plasmid pReceiver containing IGF-1 or empty plasmid in MG-63 cells transfected with miR26a to recover IGF-I expression. [score:3]
miR-26a suppresses tumor growth in mouse xenografts. [score:3]
IGF1 was overexpressed in miR-26a -transfected MG-63 cells. [score:3]
Consistent with the previous report, [16] miR-26a was significantly downregulated in osteosarcoma tissues compared to the paired bone tissues. [score:3]
[15] For example, miR-26a is overexpressed in cholangiocarcinoma and promotes cholangiocarcinoma growth by activating B-catenin. [score:3]
To evaluate the biological significance of miR-26a in the development of osteosarcoma, we transfected with miR-26a mimic or inhibitor into MG-63 and U2OS cells (Figure 2a), and examined cell proliferation using direct cell counting and MTS assays. [score:2]
To investigate the in vivo effects of miR-26a on osteosarcoma tumorigenesis, we stably overexpressed and knocked down miR-26a in MG-63 cells by lentivirus. [score:2]
Using in vitro and in vivo assays, we identify the tumor suppressor function of miR-26a in osteosarcoma. [score:2]
In contrast, knockdown of miR-26a in MG-63 cells was found to promote tumor growth in mice Figure 3b, c, and d). [score:2]
For the detection of miR-26a, RT and PCR reactions were performed by means of qSYBR-green-containing PCR kit (GeneCopoeia, Rockville, MD, USA), and U6 snRNA was used as an endogenous control for miRNA detection. [score:1]
One microgram of the wild type or mutant UTR of IGF-1 were cotransfected either with 50 nmol⋅L [−1] of miR-26a mimics or negative control (NC) into HEK293 cells using Lipofectamine 2000 (Invitrogen). [score:1]
Next, nude mice transplanted with MG-63 cells infected either with miR-26a, anti-miR-26a, or NC. [score:1]
To investigate the role of miR-26a in human osteosarcoma, we first examined miR-26a expression in n = 32 pairs of osteosarcoma tissues and pair-matched adjacent noncancerous tissues using quantitative qRT-PCR. [score:1]
MG-63 cells infected either with miR-26a, anti-miR-26a, or NC lentiviruses (Genecopies) were inoculated subcutaneously into the dorsal flanks of nude mice (five in each group). [score:1]
When we cotransfected HEK293 cells with the cloned 3’-UTR and miR-26a mimics, we observed a consistent reduction in luciferase activity for 3’-UTR by miR-26a (Figure 4b). [score:1]
These results may help us understand the molecular mechanism of osteosarcoma tumorigenesis, and provide us with a strong rationale to further investigate miR-26a as a potential biomarker and therapeutic target for osteosarcoma. [score:1]
These results suggest that the miR-26a might play a critical role in the osteosarcoma initiation. [score:1]
Among the 32 patients with osteosarcoma, approximately 79% (22 of 32 patients) of tumors revealed a more than twofold reduction in miR-26a levels, with a 5.76-fold reduction relative to adjacent normal tissues (Figure 1). [score:1]
These results indicate that miR-26a may repress osteosarcoma tumorigenesis. [score:1]
The 3’-UTR of IGF-1 mRNA (position 3689–3695 of IGF-1 3’-UTR) harbored sequences complementary to the miR-26a seed sequence (Figure 4a) and the seed-recognizing region is conserved across species. [score:1]
[1 to 20 of 53 sentences]
7
[+] score: 175
Other miRNAs from this paper: mmu-mir-26a-1, mmu-mir-26a-2, hsa-mir-26a-2
Recently, a report indicated that NF-κB might regulate miR-26a expression to regulate cardiac fibrosis, although the precise mechanism of NF-κB -suppressed miR-26a expression was not fully elucidated [29]. [score:9]
It should be pointed out that transcription factor NF-κB commonly functioned as an inducer of target genes [31], whereas in the present study we identified it as a suppressor of miR-26a by directly binding to the promoter region. [score:6]
In the present study, we are the first to report the expression of miR-26a in mouse chondrocytes and to identify NF-κB (p65) as a direct suppressor of miR-26a. [score:6]
Results demonstrated that saturated NEFA -induced NF-κB activity was attenuated by miR-26a overexpression (Figure 3C) or potentiated by miR-26a inhibition (Figure 3D), respectively. [score:5]
In the present study, we found that miR-26a could inhibit NF-κB activity by suppressing the phosphorylation of p65 in mouse chondrocytes. [score:5]
The HFD suppressed the expression of miR-26a (Figure 1C) and stimulated the chronic inflammation in chondrocytes, characterized by elevated levels of proinflammatory cytokines (IL-6, TNFα and IL-1β) and decreased expression of IL-10 (Figures 1D–1G). [score:5]
miR-26a, located in the noncoding region of ctdspl gene, was a recently identified microRNA, regulating inflammation response and cancer biology through directly targeting the mRNAs of a series of genes [25– 28]. [score:5]
Interestingly, saturated NEFA treatment notably suppressed the miR-26a production, whereas additional p65 silence rescued (Figure 3G) or p65 overexpression potentiated (Figure 3H) this effect. [score:5]
By performing site-directed mutation (Figure 4C), we figured out a potential NF-κb -binding site (ggagagtccca) locating at −1947/−1937 was responsible for p65 -inhibited activity of miR-26a promoter (Figure 4D). [score:5]
NF-κB inhibits miR-26a production via directly binding to an element in the promoter region of miR-26aTo explore how NF-κB regulates miR-26a production, we constructed a series of reporter genes harboring different miR-26a promoter sequences (Figure 4A). [score:5]
Data in (A–G), n=5, * P< 0.05, ** P< 0.01 and *** P< 0.005. miR-26a suppresses saturated non-esterified fatty acid -induced inflammatory cytokine production in mouse chondrocytesTo explore the regulatory role of miR-26a in obesity-related cytokine production in chondrocytes, we employed saturated NEFA (18:0) to mimic the condition of HFD or obesity. [score:4]
Data in A–E, n=4, * P< 0.05, ** P< 0.01 and *** P< 0.005. miR-26a suppresses saturated NEFA -induced NF-κB activity in mouse chondrocytesTo explore how miR-26a regulates proinflammatory cytokine production in chondrocytes, several inflammatory signalling pathways were scanned (data not shown). [score:4]
In the present study, we for the first time identified the expression of miR-26a in mouse chondrocytes and deciphered a reciprocal regulation between miR-26a and NF-κB, providing a potential mechanism linking obesity to the production of proinflammatory cytokines in chondrocytes. [score:4]
NF-κB inhibits miR-26a production via directly binding to an element in the promoter region of miR-26a. [score:4]
Figure 4NF-κB inhibits miR-26a production via directly binding to an element in the promoter region of miR-26a(A) A schematic depiction of different mouse miR-26a promoter regions cloned into pGL4-empty vector. [score:4]
In conclusion, reciprocal inhibition between miR-26a and NF-κB downstream of saturated NEFA signal regulates obesity-related chronic inflammation in chondrocytes. [score:4]
In obesity, elevated NEFA in circulation might stimulate NF-κB activity, which suppresses miR-26a production and further potentiates the production of proinflammatory cytokines. [score:3]
We demonstrated that the plasma NEFA levels (Figure 5A), cartilage p65 activity (Figure 5B) and TNF-α levels (Figure 5D) were positively correlated with the BMI in the patients with OA, whereas the expression of miR-26a did the opposite (Figure 5C). [score:3]
miR-26a suppresses saturated non-esterified fatty acid -induced inflammatory cytokine production in mouse chondrocytes. [score:3]
Briefly, miR-26a exerts inhibitory effect on NF-κB activity and proinflammatory cytokine production in chondrocytes. [score:3]
miR-26a suppresses saturated NEFA -induced NF-κB activity in mouse chondrocytes. [score:3]
In detail, NEFA could stimulate proinflammatory cytokine production via induction of NF-κB activity and suppression of miR-26a production in chondrocytes. [score:3]
NEFA -induced NF-κB activity suppresses miR-26a levelsTo explore the mechanism contributing to the decreased miR-26a level in obesity-related chondrocytes, we observed the role of saturated NEFA and p65 on miR-26a production. [score:3]
However, miR-26a did not affect the expression of total p65 (Figures 3A and 3B). [score:3]
In consistence, the stimulating role of NEFA in p65 phosphorylation was notably potentiated in response to miR-26a inhibition (Figure 3B). [score:3]
Furthermore, we verified the expression of miR-26a in primary mouse chondrocytes. [score:3]
NEFA induced a reciprocal inhibition between miR-26a and NF-κB in mouse chondrocytes. [score:3]
Those findings verified the reciprocal inhibitory role between NF-κB and miR-26a. [score:3]
Thus, we presumed that miR-26a regulated p65 activity in an indirect manner. [score:3]
Figure 3NEFA induced a reciprocal inhibition between miR-26a and NF-κB in mouse chondrocytes(A) The primary mouse chondrocytes were transfected with miR-26a (20 nmol/ml) or scramble miRNA (20 nmol/ml) as control for 24 h, and then treated with NEFA (200 μM) or BSA (5%) as control for 30 min. [score:3]
Inhibition of miR-26a was conducted by transfecting the chondrocytes with a miR-26a mutant (MH10249, Life Tech. [score:3]
NEFA -induced NF-κB activity suppresses miR-26a levels. [score:3]
miR-26a suppresses NEFA -induced inflammatory cytokine production in mouse chondrocytes. [score:3]
Interestingly, miR-26a could also suppress proinflammatory cytokine production via inactivating NF-κB. [score:3]
Thus, we concluded that NEFA inhibited miR-26a production through inducing the binding activity between p65 protein and the promoter sequences of miR-26a. [score:3]
Those experiments indicated that NEFA suppressed miR-26a production via activation of NF-κB in chondrocytes. [score:3]
Figure 2 miR-26a suppresses NEFA -induced inflammatory cytokine production in mouse chondrocytes(A–D) Primary chondrocytes were isolated from 12-week-old male C57BL/6 mice and cultured in vitro. [score:3]
Significantly, we demonstrated that the plasma NEFA levels, cartilage p65 activity and TNF-α levels were positively, whereas the expression of miR-26a was negatively correlated with the BMI in the patients with OA. [score:3]
Overexpression of miR-26a was performed by transfecting the chondrocytes with a miR-26a mimic (MC10249, Life Tech. [score:3]
Unfortunately, we could not verify the direct interaction between miR-26a and p65 gene. [score:2]
To explore the regulatory role of miR-26a in obesity-related cytokine production in chondrocytes, we employed saturated NEFA (18:0) to mimic the condition of HFD or obesity. [score:2]
However, the regulatory mechanism between miR-26a and those cytokines in chondrocytes is still obscure. [score:2]
To explore how miR-26a regulates proinflammatory cytokine production in chondrocytes, several inflammatory signalling pathways were scanned (data not shown). [score:2]
Reporter gene assay indicated that p65 suppressed miR-26a promoter activity via −2000/−1000 region (Figure 4B). [score:2]
To explore how NF-κB regulates miR-26a production, we constructed a series of reporter genes harboring different miR-26a promoter sequences (Figure 4A). [score:2]
To further correlate our in vitro findings to the physiopathological condition, we determined plasma NEFA levels, cartilage p65 activity, chondrocyte miR-26a and TNF-α levels as well as the body mass index (BMI) of the patients with osteoarthritis. [score:1]
Correlation of plasma NEFA levels, cartilage p65 activity, chondrocyte miR-26a and TNF-α levels with the BMI in the patients with osteoarthritis. [score:1]
NF-κB is positively and miR-26a is negatively correlated with the body mass index in the patients with OATo further correlate our in vitro findings to the physiopathological condition, we determined plasma NEFA levels, cartilage p65 activity, chondrocyte miR-26a and TNF-α levels as well as the body mass index (BMI) of the patients with osteoarthritis. [score:1]
To observe the role of miR-26a in obesity associated chondrocytes, we set up an obese mouse mo del by feeding the male C57BL/6 mice with a standard HFD for 12 weeks. [score:1]
NF-κB is positively and miR-26a is negatively correlated with the body mass index in the patients with OA. [score:1]
Figure 5Correlation of plasma NEFA levels, cartilage p65 activity, chondrocyte miR-26a and TNF-α levels with the BMI in the patients with osteoarthritis(A) Correlation of plasma NEFA levels with the BMI in the patients with osteoarthritis (n=12). [score:1]
Results showed that saturated NEFA -induced phosphorylation of p65 were largely attenuated by miR-26a transfection (Figure 3A). [score:1]
Figure 1Decreased miR-26a level and increased chronic inflammation in obesity associated chondrocytes(A) Body weight (BW) of the male C57BL/6 mice fed with a standard CD or HFD (starting at the age of 4 weeks) for 12 weeks. [score:1]
To further observe the role of miR-26a in NF-κB activity, miR-26a and a reporter gene of ccl20 promoter containing a standard NF-κB binding element were cotransfected into the primary mouse chondrocytes. [score:1]
To explore the mechanism contributing to the decreased miR-26a level in obesity-related chondrocytes, we observed the role of saturated NEFA and p65 on miR-26a production. [score:1]
miR-26a transfection significantly diminished the aforementioned effects of saturated NEFA (Figures 2A–2D). [score:1]
Decreased miR-26a level and increased chronic inflammation in obesity associated chondrocytesTo observe the role of miR-26a in obesity associated chondrocytes, we set up an obese mouse mo del by feeding the male C57BL/6 mice with a standard HFD for 12 weeks. [score:1]
The cells were transfected with miR-26a or scramble miRNA as control for 24 h, and then treated with NEFA (200 μM) or BSA (5%) as control for 30 min. [score:1]
Decreased miR-26a level and increased chronic inflammation in obesity associated chondrocytes. [score:1]
[1 to 20 of 59 sentences]
8
[+] score: 168
As miRNAs downregulate their targets on a posttranscriptional level, we also analyzed HDAC4, CDK6, and SMAD1 protein expression during osteogenic differentiation (up to day 12) of USSC 86b and in response to ectopic expression of miR-26a, miR-26b, and miR-29b in native USSC86b. [score:10]
Detailed data for all experimental validation studies are presented in Additional file 2. In summary, we identified osteo -inhibitory targets for miR-10a, miR-22, miR-26a, miR-26b, and miR-29b with the highest targeting impact resulting from miR-26a, miR-26b, and miR-29b expression. [score:9]
miR-26a/b and miR-29b are upregulated during osteogenic differentiation of USSC and share target genes inhibiting osteogenesis. [score:8]
Figure  3 summarizes the results of experimental validations from all 22 predicted miRNA-target interactions: CDK6 was targeted by miR-22, miR-26a, miR-26b, and miR-29b; CTNNBIP1 was regulated by miR-10a and miR-29b; SMAD1 and TOB1 were both recognized by miR-26a and miR-26b; and HDAC4 was targeted by miR-29b. [score:8]
Functional analyses demonstrated that miR-26a, miR-26b and miR-29b positively modulate osteogenic differentiation of USSC, most likely by downregulating osteo -inhibitory target proteins. [score:8]
To clarify the contradictory roles of osteo-promoting SMAD1 and osteo -inhibitory CDK6 and TOB1 as parallel targets of miR-26a and miR-26b, we directly analyzed target protein abundance by quantitative Western blotting (i) during osteogenic differentiation of USSC and (ii) in response to transfection of USSC with miRNA mimics. [score:8]
Several miRNAs modulate osteogenic differentiation: miR-125b negatively regulates osteoblastic differentiation through targeting VDR, ErbB2, and Osterix [28, 29]; miR-133 (targeting RUNX2) and miR-135 (recognizing SMAD5) inhibit differentiation of mouse osteoprogenitors [30]; miR-26a and miR-29b facilitate osteogenic differentiation of human adipose tissue-derived stem cells (hADSCs), and positively modulate mouse osteoblast differentiation [31, 32]. [score:8]
In contrast, endogenous expression of SMAD1, targeted by miR-26a/b, was unaltered during osteogenic differentiation of USSC or following ectopic expression of miR-26a/b. [score:7]
It is likely that miR-26a/b and miR-29b influence a common set of target genes with each miRNA making additional contributions through targeting exclusive genes e. g. HDAC4 and CTNNBIP1, which are regulated by miR-29b but not by miR-26a/b. [score:6]
miR-26a and miR-26b expression was confirmed in all native USSC lines and both miRNAs were upregulated in differentiated SA8/77 and SA4/101 lines (Additional file 1). [score:6]
In Western blot analyses demonstrated that endogenous levels of CDK6 and HDAC4 were downregulated during osteogenic differentiation of USSC and reduced following ectopic expression of miR-26a/b and miR-29b. [score:6]
Since miR-26a/b and miR-29b regulate osteo -inhibitory and osteo-promoting factors in parallel, the osteo -inhibitory effects of CDK6 and HDAC4 likely outweigh the osteo-promoting effects of SMAD1; this finding is further supported by the unaltered abundance of SMAD1 in miR-26a/b transfected USSC. [score:6]
We also identified the osteo -inhibitory BMP/SMAD regulator TOB1 [51] as a target of miR-26a and miR-26b. [score:6]
Our experimental target validations indicate that miR-26a, miR-26b, and miR-29b likely have the strongest impact on osteogenic differentiation of USSC by reducing osteo -inhibitory CDK6 and HDAC4 proteins. [score:5]
Among these inhibitors, CDK6, CTNNBIP1, HDAC4, TGFB3, and TOB1 were experimentally identified as targets of miR-26a, miR-26b, and miR-29b. [score:5]
In contrast to osteo-promoting SMAD1, osteo -inhibitory CDK6 protein expression was indeed reduced 48h post transfection with miR-26a, miR-26b, and miR-29b mimics. [score:5]
miRNA expression profiling followed by target validation indicated that miR-26a, miR-26b, and miR-29b had the highest impact on osteogenic differentiation in our USSC lines. [score:5]
In summary, we detected a subset of miRNAs, notably miR-26a, miR-26b and miR-29b, which is consistently upregulated during osteogenic differentiation of USSC. [score:4]
miR-26a modulates late osteogenic differentiation of hADSC through SMAD1 targeting [31] and we showed that both, miR-26a and miR-26b regulate SMAD1, this protein is known as a positive mediator of osteogenic differentiation [59]. [score:4]
CTNNBIP1 was also regulated by miR-10a and CDK6 [45] was targeted by miR-22, miR-26a, miR-26b and miR-29b. [score:4]
To avoid errors in measuring the expression of highly homologous miR-26a and -26b, we verified our TaqMan miRNA expression data from USSC SA5/73 and SA8/25 (Figure  1) in native USSC lines SA5/73, SA8/25, SA8/77 and SA4/101 and in (day 7) osteo differentiated SA8/77 and SA4/101, using an established small RNA sequencing method [56, 57]. [score:3]
We thus tested whether overexpression of miR-26a/b and miR-29b using miRNA mimics influences DAG -induced osteogenic differentiation. [score:3]
Among the most prominently expressed miRNAs were miR-10a, miR-152, miR-22, miR-26a/b, miR-29b, miR-30b/c, miR-345, and miR-532-5p. [score:3]
The sheet “deep sequencing” indicates results from deep-sequencing derived expression analysis of miR-26a and miR-26b in native USSC SA5/73, SA8/25, SA8/77, and SA4/101 and osteo-differentiated USSC SA8/77 and SA4/101. [score:3]
Interestingly, miR-26a and miR-26b were also predicted to regulate SMAD1, a positive regulator of osteogenic differentiation [55]. [score:3]
The most redundant miRNA-target network involved miR-26a/b and miR-29b and, to a lesser extent, miR-22, miR-10a, and miR-137 (Table  1); subsequent analyses focused on these six miRNAs. [score:3]
As with HDAC4, our results confirm that miR-26a, miR-26b, and miR-29b target CDK6. [score:3]
Interestingly, SMAD1 expression remained unchanged at day 9 post DAG induction compared to native USSC 86b (Figure  5E) and was not affected by transfection with miR-26a and miR-26b mimics (Figure  5F). [score:2]
Summarizing results from both CDK6-3 [′]-UTR fragments, significant regulatory miRNA effects were seen for miR-22, miR-26a, miR-26b, and miR-29b, whereas miR-137 had no significant effect. [score:2]
Despite targeting of the SMAD1 3 [′]-UTR by miR-26a and miR-26b in our luciferase assay (Figure  3), SMAD1 protein abundance remained unaltered upon transfection with miR-26a/b mimics (Figure  5F). [score:2]
Functional overexpression analyses using microRNA mimics revealed that miR-26a/b, as well as miR-29b strongly accelerated osteogenic differentiation of USSC as assessed by Alizarin-Red staining and calcium-release assays. [score:2]
This finding indicates a comparatively strong regulatory influence of miR-26a/b and miR-29b on CDK6. [score:2]
The strongest effect on osteogenic differentiation was observed by transfecting an equimolar mixture of miR-26a, miR-26b, and miR-29b mimics. [score:1]
Here we identified strong interactions between CDK6-2 and miR-26a and miR-26b and moderate interactions with miR-29b. [score:1]
In contrast, miR-26a/b -mimic transfected cells of both USSC lines showed significantly increased staining (Figures 6A and 6B). [score:1]
Transfection of USSC SA5/73 with miR-26a/miR-26b/miR-29b mimics further increased differentiation (Figure  6A). [score:1]
Alizarin-red staining of native uninduced USSC and DAG -induced cells are shown in comparison to DAG -induced cells transfected with a negative control smallRNA, miRNA mimics miR-26a/b (equimolar batch), miR-29b, and miR-26a/b/29b (equimolar batch). [score:1]
Functional impact of miR-26a/b and miR-29b on osteogenic differentiation of USSC. [score:1]
Figure 6. Impact of miR-26a/b and miR-29b on osteogenic differentiation on (A, scale bars 200μm) USSC SA5/73 at day 7 and (B, scale bars 500μm) on osteogenic differentiation of USSC 86b at day 7 post induction of DAG -induced differentiation was analyzed. [score:1]
We clearly demonstrated the combined functional impact of miR-26a/b and miR-29b, which had individually been identified as modulators of osteogenic differentiation in hADSC [31] and mouse osteoblasts [32]. [score:1]
USSC SA5/73 and USSC 86b were each transfected with (i) a small unspecific negative control RNA, (ii) an equimolar batch of miR-26a and miR-26b, (iii) miR-29b, and (iv) an equimolar batch of miR-26a, miR-26b, and miR-29b mimics (SA5/73 only), each followed by DAG induction. [score:1]
[1 to 20 of 41 sentences]
9
[+] score: 167
Previously, Cao et al. reported that overexpression of miR-26a reduced EZH2 expression in DU145, but not PC3 or LNCaP cells, even though miR-26a inhibited the expression of a reporter construct containing the 3′UTR of EZH2 in all three cell lines [38]. [score:9]
Second, by simultaneously binding to and inhibiting transcription of the host genes encoding miR-26a and miR-26b, Myc enforces this upregulation by inhibiting post-transcriptional silencing of EZH2 mRNA. [score:8]
Previous miRNA profiling studies in prostate cancer have reported both the down-regulation [45, 46], and the up-regulation of miR-26a [47- 49]. [score:7]
Transient transfection of miR-26a and miR-26b mimics into 5 prostate cancer cell lines resulted in suppressed proliferation, indicating that these MYC targets of repression may have tumor-suppressive functions in the context of prostate cancer. [score:7]
However, miR-26a did not regulate EZH2 in breast cancer or acute myeloid leukemia cells [5, 29], indicating that miRNA-regulation of target gene expression may be tissue and/or context specific. [score:7]
Interestingly, the 3′UTR of EZH2 contains target sites for miR-26a and miR-26b, and EZH2 was shown to be targeted for repression by miR-26a in muscle and lymphoma cells [21, 22], and of miR-26b in HeLa cells [23]. [score:5]
In a murine liver cancer mo del, in which a similar under -expression of miR-26a was observed, targeted delivery of miR-26a showed a therapeutic effect [40]. [score:5]
Myc was previously reported to regulate the expression of miRNAs [17], including miR-26a and miR-26b in P493 lymphoma cells, by direct binding to their host Pol II gene promoters (CTDSPL, CTDSP2, CTDSP1). [score:5]
By quantitative real-time PCR, we found that the expression of miR-26a was reduced in a high fraction of localized prostate cancer, and correlated negatively with the expression of both MYC and EZH2. [score:5]
There was also was an induction of CDH1 and ADRB2, known EZH2 target genes, following miR-26a and miR-26b overexpression in LNCaP cells (Fig. S2 B). [score:5]
In summary, we report that Myc can activate EZH2 expression in prostate cancer by 2 distinct mechanisms-via direct transcriptional activation of the EZH2 promoter, as well as via repression of miR-26a and miR-26b, which themselves can repress EZH2. [score:4]
Previous work in muscle, lymphoma and HeLa cells have shown that miR-26a and miR-26b can negatively regulate EZH2 expression, and that this occurs via binding to the highly conserved predicted miR-26a/b binding site within the 3′ UTR of EZH2 [21- 23]. [score:4]
Next, to determine the relevance of miR-26a and miR-26b in clinical prostate cancer, we measured their expression in 18 matched normal and primary prostate cancer specimens (Table S 2) and found both to be downregulated in cancer in most cases (Wilcoxon signed rank test, p=0.0005 for miR-26a, p=0.079 for miR-26b) (Fig. 6 A, Fig. S 3A). [score:4]
MiR-26a and miR-26b Regulate EZH2 Expression in Human and Murine Prostate Cancer Cells. [score:4]
MYC siRNA pools (Dharmacon, L-003282), siCONTROL Non-Targeting siRNA pool #1 (Dharmacon, D-001810), miRIDIAN Mimic hsa-mir-26a (Dharmacon, C-300499), miRIDIAN Mimic hsa-mir-26b (Dharmacon, C-300501) and miRIDIAN microRNA Mimic Negative Control #1 (Dharmacon CN-001000) were transfected at a final concentration of 50nM. [score:3]
Hence, we hypothesized that Myc may be a key driver of EZH2 overexpression in PIN and prostate cancer lesions via repression of miR-26a and miR-26b. [score:3]
EZH2 is a target of miR-26a and miR-26b in prostate cancer. [score:3]
Further, miR-26a and miR-26b expression was increased in MYC-CaP cells after MYC depletion (p<0.02 for both) (Fig. 4 D). [score:3]
Thus, whether miR-26a and miR-26b facilitate oncogenesis, or act as a tumor suppressor, may depend on the cellular context. [score:3]
MiR-26a and miR-26b are incorporated into the RISC complex and bind specifically to their complementary site on the 3′ UTR of EZH2, destabilizing EZH2 mRNA and repressing its translation. [score:3]
We observed a reduction in EZH2 mRNA levels in all 5 cell lines (p<0.05), and a similar decrease in EZH2 protein following transient overexpression of miR-26a and miR-26b (Fig 5 A, B). [score:3]
As such, Myc may contribute to EZH2 elevation in prostate cancer, by directly activating EZH2 transcription, and by repressing its negative regulators, miR-26a and miR-26b. [score:3]
MYC, EZH2 and miR-26a expression in localized prostate cancer samples. [score:3]
Figure 5(A,B) MiR-26a and miR-26b repress EZH2 protein (A) and mRNA (B) expression. [score:3]
Studies carried out in lymphoma cells and hepatocelluar carcinoma cells have shown that Myc represses the expression of a number of miRNAs, including miR-26a and miR-26b [17, 21]. [score:3]
Reduced miR-26a expression has been noted in various cancers, including hepatocellular carcinoma, thyroid anaplastic carcinoma, rhabdomyosarcoma and clear cell renal cell carcinoma [39- 44]. [score:3]
Figure 6(A) Reduced miR-26a expression in primary prostate cancer cases, normalized to matched benign prostate tissue. [score:3]
To determine if mir-26a and miR-26b can target EZH2 in prostate cancer cells, we transfected miR-26a and miR-26b mimics into one mouse and four human prostate cancer cell lines. [score:3]
To determine if MYC may be directly regulating miR-26a via repression of CTDSPL and CTDSP2, and miR-26b via repression of CTDSP1, we carried out chromatin immunoprecipitation on LNCaP and PC3 cells. [score:3]
There was a significant inverse correlation between the expression of MYC and miR-26a (Spearman rank correlation coefficient= −0.357, p=0.032), while that for MYC and miR-26b did not achieve statistical significance (Fig. 6 B, Fig. S 3B). [score:3]
EZH2 is a reported target of miR-26a in muscle and lymphoma cells [21, 22], and of miR-26b in HeLa cells [23]. [score:3]
The reporter promoters were transfected along with a Renilla control plasmid, and either non -targeting siRNA, MYC siRNA, miR-26a mimics, or miR-26b mimics. [score:3]
Myc represses miR-26a and miR-26b expression. [score:3]
In the Lo-MYC mouse mo del, there was a significant negative correlation between the expression of EZH2 mRNA and miR-26a (Spearman rank correlation coefficient= −0.8667, p=0.0045), as well as EZH2 mRNA and miR-26b (Spearman rank correlation coefficient= −0.8167, p=0.0108) (Fig. S2 A). [score:3]
Additionally, we observed decreased miR-26a and miR-26b expression in the Lo-MYC mice, as compared to the wildtype controls. [score:2]
Myc Regulates miR-26a and miR-26b in Human and Murine Prostate Cancer Cells. [score:2]
MiR-26a Expression in Primary Prostate Cancer Specimens. [score:2]
Co-transfection with either miR-26a mimics, miR-26b mimics or Myc siRNA resulted in reduced reporter activity, as compared to transfection with a non -targeting miR (p<0.03) (Fig. 5 C). [score:2]
Mature miR-26a and miR-26b expression was measured by Taqman assay (Applied Biosystems) according to manufacturer's instructions, and normalized against U6 expression. [score:2]
Following MYC-depletion, we found a coordinate increase in the mRNA levels of CTDSPL, CTDSP2 and CTDSP1, and both the mature and primary forms of miR-26a and miR-26b in all 4 cell lines (p<0.02 for all) (Fig. 4 A). [score:1]
In prostate cancer cells, we found that both miR-26a and miR-26b repressed both EZH2 mRNA and protein. [score:1]
Using this construct, there was no significant reduction in reporter activity following co-transfection with miR-26a mimics, miR-26b mimics or Myc siRNA (Fig. 5 C). [score:1]
MiR-26a and miR-26b have been reported to be Myc -repressed in lymphoma cells [17, 21]. [score:1]
To determine the biological relevance of miR-26a and miR-26b in prostate cancer cells, we assessed the effect of miR-26a and miR-26b transfection on the proliferation of 4 human prostate cancer cell lines and the Myc -driven mouse prostate cancer cell line. [score:1]
This suggests that Myc -mediated repression of miR-26a and miR-26b may be an important factor in maintaining the proliferative capacity of prostate cancer cells. [score:1]
Since MYC represses the transcription of CTDSPL, CTDSP2 and CTDSP1, when MYC levels are low, these genes, which harbor miR-26a and miR-26b, are actively transcribed. [score:1]
However, miR-26a has been reported to be amplified in gliomas, and to promote gliomagenesis [43]. [score:1]
By quantitative real-time PCR, we found that Myc represses miR-26a and miR-26b in all prostate cancer cell lines studied. [score:1]
Further, using heterologous reporter constructs we found that the conserved miR-26a/b binding site within the 3′ UTR of EZH2 was required for this repression. [score:1]
Concurrently, MYC represses CTDSPL, CTDSP2 and CTDSP1, in which miR-26a and miR-26b are embedded. [score:1]
We also observed significant inverse correlations between miR-26a and EZH2 mRNA (Spearman rank correlation coefficient= −0.516, p=0.0013), and miR-26b and EZH2 mRNA (Spearman rank correlation coefficient= −0.3552, p<0.0392) (Fig. 6 C, Fig. S 3C). [score:1]
Inverse correlations were observed between MYC and miR-26a/b (B), as well as miR-26a/b and EZH2 (C). [score:1]
To verify specific associations between miR-26a and miR-26b and their predicted binding site on the EZH2 3′UTR in prostate cancer cells, we cloned the 3′UTR of EZH2 into a luciferase reporter vector [21]. [score:1]
In LNCaP and PC3 cells, we observed an enrichment of Myc binding at the promoter regions of CTDSPL, CTDSP2 and CTDSP1, genes whose introns harbor the miR-26a and miR-26b primary transcripts. [score:1]
Figure 4(A) (Upper Panel) Induction of miR-26a, its primary forms miR-26a1 and miR-26a2, and the genes in which they are embedded, CTDSPL and CTDSP2, following siRNA -mediated Myc depletion. [score:1]
As an additional control, we generated a luciferase reporter vector with a truncated EZH2 3′UTR, which lacks the miR-26a/b binding site. [score:1]
siRNA -mediated MYC depletion in 4 human prostate cancer cell lines was followed by quantitative real-time PCR to measure the expression of the mature miR-26a, its 2 primary forms, mir-26a1, and mir-26a2, as well as the host genes in which they are embedded, CTDSPL and CTDSP2. [score:1]
[1 to 20 of 57 sentences]
10
[+] score: 161
Over -expressing miR-26a Promoted EOC Cell Growth and Inhibiting miR-26a Suppressed EOC Cell Proliferation. [score:7]
Given the fact that miR-26a was involved in proliferation of EOC cells and ERα was a target of miR-26a, we next tested whether over -expression of ERα could rescue promotion of proliferation by miR-26a in EOC cells. [score:5]
Our results obtained from gain-of-function and loss-of-function approaches indicated that miR-26a promoted proliferation and inhibition of miR-26a suppressed EOC cell proliferation. [score:5]
In our results, the expression of miR-26a in specimens and plasma in EOC were much higher than those in normal ovary samples, and miR-26a promote EOC cell proliferation by targeting ERα. [score:5]
We demonstrate that inhibition of miR-26a decreased proliferation of human EOC cells, and suppressed growth of EOC cells in nude mice. [score:5]
We next examined whether miR-26a could regulate endogenous ERα expression in EOC cells. [score:4]
Genome-wide miRNA expression profiling showed miR-26a dysregulation in diverse cancers [10]. [score:4]
Moreover, miR-26a regulated liver tumor cell growth by targeting ERα [22]. [score:4]
These results indicate that miR-26a controlled proliferation of EOC cells through regulation of ERα expression. [score:4]
In addition, ERα was down-regulated by miR-26a in EOC cells. [score:4]
Increased Expression of miR-26a in Specimens and Plasma in Human EOC. [score:3]
In this study, we have shown that expression level of miR-26a was greatly increased in human EOC samples, and blood -based miR-26a level can distinguish patients from healthy controls in EOC. [score:3]
QRT-PCR analysis showed that miR-26a expression level was greatly increased in S1 and S2 cells (Figure S1). [score:3]
Compared with control, endogenous ERα mRNA levels (Figure 3B) and protein levels (Figure 3C) were down-regulated when cells were transfected with miR-26a. [score:3]
Moreover, ERα was a target for miR-26a in EOC cells. [score:3]
In conclusion, inhibition of miR-26a decreased EOC cell growth in culture and in nude mice. [score:3]
0086871.g003 Figure 3ERα was a target of miR-26a. [score:3]
As shown in Figure 1A, the expression levels of miR-26a in tumor samples were much higher than those in normal ovary samples. [score:3]
In this study, we found that miR-26a is over-expressed in human EOC. [score:3]
Furthermore, expression level of miR-26a affected tumor formation in nude mice. [score:3]
We examined the expression of miR-26a in 26 tumor samples and 19 normal ovaries. [score:3]
An important implication of current study is that miR-26a might be a potential target for therapeutic intervention to human EOC. [score:3]
Table S2 clinicopathologic data and miR-26a expression level of ovarian cancer patients. [score:3]
0086871.g001 Figure 1The expression of miR-26a was increased in EOC patients. [score:3]
As shown in Figure 2A, the growth ability of S KOV3 and ES2 cells was increased by over -expression of miR-26a. [score:3]
It has been observed that the expression level of miR-26a was decreased or increased in human malignancies, such as breast carcinoma [16], nasopharyngeal carcinoma [17], [18], and glioblastoma [19], indicating a complicated role of miR-26a in progression of the malignancies. [score:3]
Table S1 clinicopathologic data and miR-26a expression level of control. [score:3]
Moreover, stable expression of miR-26a in two S KOV3 cell clones (S1 or S2) increased the growth of the cells about 1.58 or 1.37 fold, respectively (Figure 3D). [score:3]
ERα was a target of miR-26a. [score:3]
In patients with hepatocellular carcinoma, the expression of miR-26a was higher in women than in men [21]. [score:3]
QRT-PCR determined the expression levels of miR-26a in S1 and S2 cells. [score:3]
Our results also displayed that expression level of miR-26a affected EOC cell growth in culture. [score:3]
To provide direct evidence that miR-26a was responsible for EOC development, S KOV3 cells transfected with either miR-26a or anti-miR-26a were injected into the flank of nude mice as described. [score:3]
The expression of miR-26a was increased in EOC patients. [score:3]
ERα was a Target Gene of miR-26a in EOC Cells. [score:3]
Our study suggests that aberrant expression of miR-26a is critical for the development of human EOC and measurement of circulating miR-26a may be a good approach to EOC diagnosis. [score:2]
Therefore, our results are consistent with an idea that miR-26a is critical for the development of human EOC. [score:2]
The results mentioned above suggest that miR-26a was critical for the development of EOC in vivo. [score:2]
MiR-26a affected proliferation of EOC cells by targeting ERα. [score:2]
To investigate the possible role of miR-26a in EOC development, we first examined the expression of miR-26a in specimens and plasma in EOC by SYBR-Green stem-loop qRT-PCR [20]. [score:2]
Figure S1 MiR-26a expression level was greatly increased in S1 and S2 cells. [score:2]
Together, these results provide us initial evidence that miR-26a may play a role in the development of human EOC. [score:2]
Recent microarray profile data shows miR-26a dysregulation in diverse cancer [4]. [score:2]
Together, these results suggest that miR-26a was indeed involved in the regulation of EOC cell growth. [score:2]
The average weight of the tumor generated from empty vector was 0.433±0.07, whereas the average weight of the tumor generated from miR-26a was 0.821±0.02 (gram, P<0.01). [score:1]
We next examined whether miR-26a affects EOC cell growth using S KOV3 and ES2 cells as mo dels. [score:1]
MiR-26a promoted the development of tumor in nude mice. [score:1]
S KOV3 cells transfected with miR-26a or anti-miR- 26a separately. [score:1]
Anti-miR-26a and nonsense of anti-miR were from GenePharma (Shanghai, PR China). [score:1]
On the contrary, miR-26a facilitates glioblastoma formation as an oncogene [19]. [score:1]
Growth curves of S KOV3 (A) or ES2 (B) cells transfected with miR-26a (left panel) or anti-miR-26a (right panel). [score:1]
Full-length human miR-26a was amplified from human genomic DNA and cloned into the pcDNA3.1 at KpnI and XhoI sites according to the previous report [13] and [14]. [score:1]
A total of 500 cells transfected with miR-26a or empty vector (Ctrl) were seeded in 35 mm dishes separately in triplicate. [score:1]
Furthermore, we found that extracellular miR-26a levels in plasma can distinguish patients from healthy controls in EOC. [score:1]
The number and size of the colonies formed were markedly increased in miR-26a transfected cells (Figure 2D). [score:1]
Similarly, the concentrations of miR-26a were higher in plasma from EOC patients (n = 17) than in that from healthy controls (n = 13) (Figure 1B). [score:1]
These results suggest that miR-26a indeed affected EOC cell growth. [score:1]
Our results investigate the possibility of miR-26a applied as a biomarker in clinical setting through examining the expression of miR-26a in plasma of EOC patients. [score:1]
The tumor volume generated from empty vector was 0.435±0.042 (cm [3], P<0.01), that in miR-26a group was 0.829±0.172 (cm [3], P<0.01) (Figure 4A), that in negative control group was 0.941±0.163 (cm [3], P<0.01), and that in anti-miR-26a was 0.248±0.05 (cm [3], P<0.01) (Figure 4B). [score:1]
In liver cancer, miR-26a protects normal liver tissue from hepatocellular carcinoma-promoting inflammation [21], and appears to antagonize human breast cancer [16] and rhabdomyosarcoma [28]. [score:1]
It means that miR-26a might be an important factor in the survival of ovarian cancer. [score:1]
The cells were transfected with miR-26a or anti-miR- 26a using FuGene HD (Roche, Indianapolis, IN) according to the manufacturer’s protocol. [score:1]
0086871.g004 Figure 4 MiR-26a promoted the development of tumor in nude mice. [score:1]
The average weight of the tumor generated from nonsense was 1.062±0.169, whereas the average weight of the tumor generated from anti-miR-26a was 0.473±0.05 (gram, P<0.01), respectively. [score:1]
MiR-26a Promoted the Development of Tumor in Nude Mice. [score:1]
[1 to 20 of 65 sentences]
11
[+] score: 133
Here miR-21 was up-regulated and miR-26a was down-regulated after TCR-specific in vitro stimulation of naïve T cells and M. tuberculosis specific T cells of LTBI. [score:7]
The predicted candidate miRNA targets expressed in immunological tissues (i. e. 201 genes for miR-21; 287 genes for miR-142-3p; 515 genes for miR-26a; and 580 genes for miR-29a) were then analyzed for overlapping target groups. [score:7]
Expression of miR-21 (triangles), miR-26a (squares), miR-29a (circles), miR-142-3p (diamonds), and miR-155 (hexagons) was compared between IFNγ -expressing T [H]1 (open symbols, n = 11) and IL-17 -expressing T [H]17 clones (black symbols, n = 9) of healthy donors prior to (A) and after in vitro activation (B). [score:6]
Our results confirm miR-26a down-regulation after T-cell receptor specific stimulation and likely reflect involvement in T-cell activation and development. [score:5]
Ongoing studies aim at validating additional common targets of miRNA candidates to claryfy the role of miR-21, miR-26a, miR-29a, and miR-142-3p expression in tuberculosis. [score:5]
Consistent pattern of differentially expressed miR-21, miR-26a, miR-29a, and miR-142-3p suggested a role of these candidates in T-cell immunity during tuberculosis disease and recovery. [score:5]
Recently a comprehensive study of miRNA expression in T cells detected decreased expression of miR-26a upon in vitro T-cell activation [37]. [score:5]
Predicted miR-21, miR-26a, miR29a, and miR-142-3p targets from the miRGen Internet platform were determined for expression in immunological tissues using Unigene Internet database (for details see ). [score:5]
Median expression levels and standard deviations of all determined miRNAs are shown in Table 1. Four miRNAs, namely miR-21, miR-26a, miR-29a, and miR-142-3p, were differentially expressed between tuberculosis patients and LTBI (P = 0.035, P = 0.005, P = 0.008, and P = 0.002, respectively), whereas no differences were detected between LTBI and PPDneg (Table 1 and Figure 1A). [score:5]
In addition, the level of differentially expressed miRNAs of tuberculosis patients and controls correlated significantly and therefore, common regulation for miR21, miR-26a, miR-29a, and miR-142 was likely. [score:4]
We identified trends of increased miRNA candidates expression (P = 0.07 for miR-21; P = 0.12 for miR-26a) after recovery as compared to active disease (Figure 2B). [score:4]
It is tempting to speculate that c-myc is part of the mechanisms leading to concordant down-regulation of miR-26a, miR-29a (and probably miR-21). [score:4]
Although the expression of miRNAs was heterogeneous between individuals, we detected markedly lower expression of miR-26a (P<0.01), miR-29a (P<0.01), and miR-142-3p (P<0.05) in children with tuberculosis as compared to children with LTBI (Figure 2A). [score:4]
One common target predicted for miR-21, miR-26a, and miR-29a was PTEN, a regulatory protein involved in T cell receptor signaling [30]. [score:4]
A crucial T-cell regulator identified as target of miR-21, miR-26a, and miR-29a is PTEN (phosphatase and tensin homolog deleted on chromosome 10). [score:4]
Besides regulating the important miR-17-92 cluster, c-myc has also been shown to suppress miR-26a and miR-29 family members [32], [33]. [score:4]
Expression of miR-21, miR-26a, miR-29a and miR-142-3p after in vitro Re-stimulation of Naïve T Cells. [score:3]
Notably the level of differentially expressed miRNAs correlated markedly in T cells from individual donors (miR-21/miR-26a, P = 0.001; miR-21/miR-29a, P = 0.002; miR-21/miR-142-3p P = 0.001; miR-26a/miR-29a P<0.0001; miR-26a/miR-142-3p P<0.0001; miR-29a/miR-142-3p P<0.0001) (data not shown). [score:3]
Expression of miR-21, miR-26a, miR-29a and miR-142-3p in Human T [H]1 and T [H]17 ClonesIFNγ-secreting T [H]1 cells are crucial for protective immunity against M. tuberculosis infection [27]– [29]. [score:3]
Notably, miR-21, miR-26a, miR-29a, and miR-142-3p expression levels were comparable between children with tuberculosis and PPDneg children. [score:3]
The present study provided evidence for a role of miR-21, miR-26a, miR-29a, and miR-142-3p in the immune response against human tuberculosis, a chronic infectious disease. [score:3]
Target genes and overlaps for miR-21, miR-26a, miR-29a and miR-142-3p. [score:3]
Expression of miR-21 (triangles), miR-26a (squares), miR-29a (circles), and miR-142-3p (diamonds) in CD4 [+] T cells from tuberculosis patients (TB) (black symbols, n = 6), LTBI (grey symbols, n = 7), and PPD negative healthy controls (PPDneg) (open symbols, n = 3). [score:3]
Analyses of miRNA candidates in whole blood of children with tuberculosis and contacts verified lower miR-26, miR-29a, and miR-142-3p expression in children with tuberculosis. [score:3]
The expression of miR-21, miR-26a, miR-29a, and miR-142-3p was homogeneous within the study groups and already moderate numbers of tuberculosis patients, LTBI, and PPDneg were sufficient to detect significant differences. [score:3]
0061609.g006 Figure 6(A) A Venn diagram indicates the overlap of target genes for miR-21, miR-26a, miR-29a and miR-142-3p. [score:3]
Expression of miR-21, miR-26a, miR-29a and miR-142-3p in Human T [H]1 and T [H]17 Clones. [score:3]
We concluded that miR-21 expression increased upon activation of naïve CD4 [+] T cells in vitro whereas miR-26a decreased upon T-cell activation in vitro. [score:3]
0061609.g002 Figure 2Expression of miR-21 (triangles), miR-26a (squares), miR-29a (circles), and miR-142-3p (diamonds) in whole blood is shown for children with tuberculosis (TB, black symbols), healthy latently M. tuberculosis children (LTBI, grey symbols), and PPD negative contacts (PPD [neg], open symbols) (A) as well as for children with tuberculosis under therapy and recovery (B). [score:3]
MiR-21 and miR-26 showed differential expression after in vitro re-stimulation. [score:3]
A trend of decreased expression was also detected for miR-26a on day seven (Figure 3B). [score:3]
Expression of miR-21 (triangles), miR-26a (squares), miR-29a (circles), and miR-142-3p (diamonds) in whole blood is shown for children with tuberculosis (TB, black symbols), healthy latently M. tuberculosis children (LTBI, grey symbols), and PPD negative contacts (PPD [neg], open symbols) (A) as well as for children with tuberculosis under therapy and recovery (B). [score:3]
MiR-21 and miR-26a were shown to be regulated during T-cell activation. [score:2]
MiR-26a expression decreased until day three post stimulation and remained relatively stable until day seven (P = 0.02) (Figure 3). [score:2]
No differences were detected for miR-21, miR-26a, miR-142-3p and miR-155 upon activation (Figure 4B). [score:1]
This rendered a common cause of decreased miR-21, miR-26a, miR-29a, and miR-142-3p of CD4 [+] T cells from tuberculosis patients likely. [score:1]
We found no evidence for a correlation of miR-21 (Figure 6B; upper left graph), miR-26a (Figure 6B; upper right graph), or miR-29a (Figure 6B; lower graph) with PTEN protein levels. [score:1]
[1 to 20 of 37 sentences]
12
[+] score: 119
Other miRNAs from this paper: hsa-mir-155, hsa-mir-26a-2, hsa-mir-326, hsa-mir-18b, hsa-mir-599
Predicted miR-26a-5p target genes identified by TargetScan, PicTar, Miranda and miRBase Target database search. [score:7]
Since DLG4 contains a 8-nt miR-26a-5p binding site in its 3′ UTR, these results might suggest that miR-26a-5p up-regulation could have a significant impact on the regulation of DLG4 gene expression in INF- β treated responder subjects. [score:7]
Therefore, we explored putative miR-26a-5p target genes by searching them on three distinct web-accessible miRNA target databases, including TargetScan, PicTar, and miRDB [13]. [score:7]
Significant up-regulation of the expression of putative miR-26a-5p targets, DLG4, was evaluated by qPCR in INF-b treated MS patients leukocytes. [score:6]
We hypothesized, therefore, that mir-26a-5p might down-regulate the expression level of glutamate-signaling related genes in INFβ- treated MS patients. [score:6]
29 82NM_004272HOMER1homer homolog 1 (Drosophila)-0.13  NM_133445GRIN3Aglutamate receptor, ionotropic, N-methyl-D-aspartate 3A-0.54  NM_004170SLC1A1solute carrier family 1 (neuronal/epithelial high affinity glutama te transporter, system Xag), member 1-0.821.57  NM_001077484 SLC38A1 solute carrier family 38, member -0.07     The expression of miR-26a-5p gene targets, representing key role in Glutamate Receptor Signaling biological pathway selected by “MicroRNA Target Filter” program from IPA (Table  3), was evaluated by qPCR. [score:5]
Among these, only hsa-miR-26a-5p, which has been shown to be mainly expressed in neural tissue [14], showed the most significant expression change in IFN-β treated RRMS patients, at different therapy stages. [score:5]
Beside the effects on immuno-modulatory system and metalloproteinase 9 [29], IFN-β has been shown to be neuroprotective against the toxicity induced by activated microglia in cortical neurons and microglia co-cultures, suppressing the production of glutamate and superoxide by activated microglia [30] Considering that the expression level mir-26a-5p changed, these variations can have a significant impact on a patient’s INF - β-response and glutamate activity. [score:5]
Functional annotations of hsa-mir-26a-5p targets revealed that several genes were implicated in Glutamate Receptor Signaling pathway, which is notoriously altered in neurodegenerative diseases as MS. [score:5]
Beside, qPCR results have demonstrated that DLG4 expression decreased after 3 months treatment, showing a significant inverse correlation to mir-26a-5p expression. [score:5]
Interestingly, a subset of mir-26a-5p potential genes target, selected by “MicroRNA Target Filter” program from IPA, were implicated in Glutamate Receptor Signaling metabolism (Table  3), which is altered in brains of multiple sclerosis patients [15]. [score:5]
As shown in Figure  5, after 6 months IFN-β treatment, DLG4 expression showed a significant negative correlation to miR-26a-5p expression (Pearson’s correlation r = - 0.995 (P = 0.003). [score:5]
Differential expression of miR-26a-5p gene targets in the blood of IFN-β treated SM patients. [score:5]
MiR-26a-5p expression did not show any significant expression change in a group of IFN-β treated non-responder MS patient (Figure  2). [score:4]
Figure 5 Correlation of miR-26a-5p and DLG4 expression level in MS patients leukocytes after 6 months IFN-β treatment. [score:3]
In our research, mir-26a-5p, showed a significant change in the level of expression, based on the INF-βresponse, at the different stages of treatment in INF-β treated responder RRMS (Figure  2). [score:3]
We found, for the first time, that the expression of a specific miRNA, hsa-mir-26a-5p, changed during INF-β treatment in responder RRMS patients. [score:3]
The expression levels of miR-26a-5p in the response to treatment were consistently and significantly higher in IFN-β treated RRMS patients at 3 months treatment, keeping stable at 6 months treatments in all patients. [score:3]
Computational predictions of the putative targets of miR-26a-5p. [score:3]
A significant correlation between miR-26a-5p and DLG4 expression levels was observed (Pearson’s correlation coefficient = -0.995, P = 0.003). [score:3]
Indeed,, the following hypothetical candidate genes of miR26a-5p have been identified as target genes, DLG4, HOMER1, GRIN3A SLC1A1, SLC38A1 (Table  3). [score:3]
Ingenuity Pathway Analysis (IPA) software identified biological pathways associated with predicted miR-26a-5p targets. [score:3]
For the first time, we found that the expression level of miR-26a-5p changed related to INF-β response. [score:3]
The expression of miR-26a-5p is increased in the blood of IFN-β treated SM patients. [score:3]
Following, by Real-Time qPCR assay, we assessed, that, among the identified microRNAs, hsa-mir-26a-5p expression was significantly higher in IFN-β treated RRMS patients at 3 months treatment, keeping quite stable at 6 months treatments. [score:2]
The expression of mir-26a-5p was studied in the peripheral blood from 40 IFN-β treated responder RRMS patients and from 10 IFN-β treated non-responder patients, at starting, at 3 and 6 months IFN-β treatment by microRNA assay -based quantitative RT-PCR following the 2 [-ΔΔCT] method. [score:2]
MiR-26a-5p expression was significantly higher in IFN-β treated RRMS patients at 3 months treatment, keeping quite stable at 6 months treatments. [score:2]
Figure 3 Gene networks regulated by miR-26a-5p. [score:2]
Figure 2 MiR-26a-5p expression levels in INF-β treated MS patient leukocytes. [score:2]
MiR-26a-5p expression was significantly higher in IFN-β treated responder RRMS patients at 3 months treatment compared to the baseline, keeping quite stable at 6 months treatments (Figure  2). [score:1]
We were able to identify 6 mature miRNA species, miR-326, miR-155, miR-3676, miR-18b, miR-599 and miR-26a-5p deriving from known human stem-loop sequences (miRBase 12.0). [score:1]
[1 to 20 of 31 sentences]
13
[+] score: 108
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-27a, hsa-mir-26a-2
It has been reported that down-regulation of miR-26a is associated with poor prognosis in patients with osteosarcoma, and the patients with low miR-26a expression tended to have a shorter overall and disease-free survival time. [score:8]
Song et al. suggested that down-regulation of miR-26a is associated with tumor aggressiveness and tumor metastasis, and miR-26a inhibits cell migration and invasion by targeting the EZH2 gene in osteosarcoma [25]. [score:8]
Fig 1 MiRNAs expression levels in osteosarcoma and adjacent normal tissues The results indicated that low expression level of miR-26a and high expression of miR-27a were associated with high TNM stage (P = 0.001; P = 0.012), tumor grade (P = 0.007; P = 0.016), and distant metastasis (P = 0.004; P = 0.001). [score:7]
Fig 2Relationship between miRNAs expression levels and survival time (log-rank test: P < 0.001) Multivariate Cox proportional hazards mo del analysis showed that low expression of miR-26a and high expression of miR-27a (P = 0.021; P = 0.011), high TNM stage (P = 0.001; P = 0.003), tumor grade (P = 0.005; P = 0.01), and distant metastasis. [score:7]
Down-regulated miR-26a has been reported to play an important role in the progression of tumor, and miR-26a functions as a potential tumor suppressor in different types of cancer [12– 14]. [score:6]
Our result suggested that miR-26a expression level in osteosarcoma bone tissue was significantly lower than that in the paired noncancerous bone tissues (mean ± SD: 5.12 ± 2.53; 10.75 ± 3.23; P = 0.001; Fig.   1), Furthermore, miR-27a expression was higher in osteosarcoma bone tissue in comparison with paired noncancerous bone tissues (mean ± SD: 6.35 ± 1.23; 2.85 ± 0.64; P = 0.003; Fig.   1). [score:5]
It has been reported that miR-26a can suppress cell differentiation, migration and invasion by targeting a number of genes [15, 16]. [score:5]
Multivariate Cox proportional hazards mo del analysis showed that low expression of miR-26a and high expression of miR-27a (P = 0.021; P = 0.011), high TNM stage (P = 0.001; P = 0.003), tumor grade (P = 0.005; P = 0.01), and distant metastasis. [score:5]
Kaplan-Meier analysis and log-rank test indicated that patients with low expression of miR-26a and high expression of miR-27a had shorter overall survival (log-rank test: P < 0.001). [score:5]
It has been reported that miR-26a can suppress cell differentiation, migration and invasion by targeting a number of genes including, SMAD1, MTDH, CDK6, CCNE1, CCNE2 CCND2, PTEN, PB1, MAP3K2 and enhancer of zeste homolog 2 (EZH2) [15, 16]. [score:5]
In current study, Kaplan-Meier analysis and log-rank test indicated that patients with low expression of miR-26a had shorter overall survival than those with high miRNAs expression. [score:5]
The results indicated that low expression level of miR-26a and high expression of miR-27a were associated with high TNM stage (P = 0.001; P = 0.012), tumor grade (P = 0.007; P = 0.016), and distant metastasis (P = 0.004; P = 0.001). [score:5]
The results indicated that patients with low expression of miR-26a and high expression of miR-27a had shorter overall survival (log-rank test: P < 0.001; Fig.   2). [score:5]
MiR-26a was down-regulated and may serve as a potential cancer suppressor in various kinds of cancer such as nasopharyngeal carcinoma, hepatocellular carcinoma, thyroid anaplastic carcinomas and breast cancer [12– 14]. [score:5]
In conclusion, our findings suggested that expression level of miR-26a and miR-27a contributes to aggressive progression of this malignancy. [score:3]
The decreased expression of miR-26a in osteosarcoma tissues has been reported to be significantly correlated with adverse clinicopathological features including adverse clinical stage and with the presence of distant metastasis. [score:3]
Also it was indicated that the expression of miR-26a may be a prognostic factor for overall and disease-free survival independent of these adjusted clinicopathologic characteristics [25]. [score:3]
However, there were no significant correlations of miR-26a and miR-27a expression levels with other clinical features. [score:3]
Multivariate Cox proportional hazards mo del analysis showed that low expression of miR-26a high TNM stage, tumor grade, and distant metastasis were independent prognostic factors for overall survival patients with osteosarcoma cancer. [score:3]
Real-time PCR was applied to quantify the expression level of miR-26a and miR-27a. [score:3]
The low expression level of miR-26a was associated with high TNM stage, tumor grade, and distant metastasis. [score:3]
On the other hand, miR-26a was remarkably expressed in lymph node metastatic tumors when compared with primary tumors and enhanced lung cancer cell migration and invasion [15]. [score:2]
Moreover, miR-26a was remarkably expressed in lymph node metastatic cancers when compared with primary cancers and enhanced lung cancer cell migration and invasion [15]. [score:2]
The correlation of miR-26a and miR27a expression with overall survival of osteosarcoma patients was investigated by Kaplan-Meier analysis and log-rank test. [score:1]
However, the expression of miR-26a and miR-27a in osteosarcoma need further investigation in clinical samples. [score:1]
[1 to 20 of 25 sentences]
14
[+] score: 102
Exogenous expression assays revealed that miR-10b and miR-26a, but not miR-146a, can down-regulate the expression of BRCA1 in both triple -negative MDA-MB-231 and luminal epithelial MCF7 breast cancer-derived cells, whereas miR-153 could down-regulate BRCA1 expression only in MCF7 cells. [score:12]
After miR-26a transfection into MDA-MB-231 and MCF7 cells, the expression level of BRCA1 was again found to be decreased in both of them (Fig. 2), indicating that also miR-26a can down-regulate the expression of BRCA1 in MDA-MB-231 and MCF7 cells. [score:8]
Another potential biomarker of triple -negative breast cancer that we identified is miR-26a, and we found that miR-26a can down-regulate the expression of BRCA1 in MDA-MB-231 and MCF7 cells. [score:6]
BRCA1 expression is regulated by miR-10b, miR-26a and miR-153The above expression profiling and in silico analyses allowed us to select 4 miRNAs, miR-10b, miR-26a, miR-146a and miR-153 for further analysis. [score:6]
miR-26a was found to be expressed in all 10 cell lines, and to be higher expressed in the triple -negative cell lines than the luminal cell lines (MCF7, T47D) (Fig. 1b). [score:5]
BRCA1 expression is regulated by miR-10b, miR-26a and miR-153. [score:4]
Based on our expression profiling results, four candidate miRNAs (miR-10b, miR-26a, miR-146a and miR-153) were selected as being potentially involved in triple -negative breast cancer development. [score:4]
A total of 519 patients with information on ER, PR and HER2 status were selected to compare the expression profiles of four selected miRNAs (miR-10b, miR-26a, miR-146a and miR-153) in the respective tumors. [score:3]
We found that miR-26a significantly stimulated the proliferation of MDA-MB-231 cells and inhibited the proliferation of MCF7 cells. [score:3]
Expression of BRCA1 was determined by qRT-PCR in MDA-MB-231 and MCF7 cells transfected with Tmock (transfection reagent only), miR-146a, anti-miR-146a, miR-153, miR10-b and miR-26a. [score:3]
For miR-26a, the difference in average expression was not found to be significant in these tumors (p = 0.6234). [score:3]
miR-10b and miR-26a are preferentially expressed in triple -negative breast cancer-derived cell lines. [score:3]
In contrast, Gao et al. reported that miR-26a could inhibit the proliferation and migration of breast cancer cells through repression of MCL-1, and that miR-26a could increase the sensitivity of breast cancer cells to paclitaxel [38]. [score:3]
All experiments were performed in triplicate TCGA was queried for the expression of miR-10b, miR-26a, miR-146a and miR-153 in different primary breast cancer tissues. [score:3]
Only two of these miRNAs (i. e., miR-10b and miR-26a) were found to be well-expressed in these cell lines. [score:3]
The efficiency of the miRNA mimics and inhibitors was verified by miRNA quantification using qRT-PCR (Fig. S2), revealing sufficient efficiencies only for miR-10b, miR-26a, miR-146a, anti-miR-146a and miR-153. [score:3]
Differential expression of miR-10b, miR-26a, miR-146a and miR-153 in TCGA. [score:3]
The above expression profiling and in silico analyses allowed us to select 4 miRNAs, miR-10b, miR-26a, miR-146a and miR-153 for further analysis. [score:3]
We also found that the average expression of miR-26a was not significantly different between triple -negative and non triple -negative breast tumors in the TCGA database. [score:3]
For this analysis we focused on six miRNAs that were found to be differently expressed in at least two subgroups by PCR Array, i. e., miR-10b, miR-15b, miR-26a, miR-155, miR-206 and miR-485-5p (Table 2, Table S3). [score:3]
Others found that miR-26a can promote ovarian cancer cell proliferation by targeting ERα [39]. [score:3]
In MCF7 cells, miR-153, miR-10b and miR-26a significantly inhibited proliferation compared to mock -transfected cells (Fig. 3). [score:2]
Here, expression profiling, transfection and in silico assays were performed to identify potential triple -negative breast cancer miRNA biomarkers, i. e., miR-10b, miR-26a, miR-146a and miR-153. [score:2]
J. Gao, L. Li, M. Wu, M. Liu, X. Xie, J. Guo, H. Tang, X. Xie, MiR-26a inhibits proliferation and migration of breast cancer through repression of MCL-1. PLoS One 8, e65138 (2013) 39. [score:2]
The expression of four miRNAs (miR-10b, miR-26a, miR-146a and miR-153) was compared in 88 breast tumors with a negative ER, PR and HER2 status (i. e., triple negative phenotype) and in 431 breast tumors that were positive for at least one of the receptors. [score:2]
To assess the effect of miR-10b, miR-26a, miR146a, anti-miR-146a and miR-153 on MDA-MB-231 and MCF7 cell proliferation, the cells were transfected with the respective (anti-) miRNAs, as also siBRCA1 and Tmock (transfection reagent alone). [score:1]
MDA-MB-231 cells and MCF7 cells were collected, seeded at a density of 3000 cells per well into a 96-well plate and cultured in a humified incubator at 37 °C containing 5 % CO2 for 24 h. Subsequently, the cells were transfected with Tmock (transfection reagent alone), siBRCA1, miR-146a, anti-miR-146, miR-153, miR-10b and miR-26a using Lipofectamine 2000 reagent (Invitrogen, CA, USA) according to the manufacturer’s protocol. [score:1]
In conclusion, we identified miR-10b, miR-26a, miR-146a and miR-153 as potential triple -negative breast cancer biomarkers. [score:1]
Cells were transfected with Tmock (transfection reagent only), siBRCA1, miR-146a, anti-miR-146, miR-153, miR-10b and miR-26a. [score:1]
The role of miR-26a thus appears to be complex and may dependent on the tissue and/or tumor context. [score:1]
In MDA-MB-231 cells, the proliferation assay (see materials and methods) showed that miR-26a significantly stimulated and that miR-146a inhibited proliferation compared to mock -transfected cells. [score:1]
Based on these results we focused our further analyses, next to miR-10b and miR-26a, on miR-146a and miR-153. [score:1]
[1 to 20 of 32 sentences]
15
[+] score: 67
RT-qPCR was performed on 5 differentially expressed miRNAs (3 upregulated: miR-466, miR-574-3p, miR-3613-3p; and 2 downregulated: miR-1, miR-26a-5p) to confirm the microarray data. [score:9]
The miRNAs hsa-miR-1 and hsa-miR-26a-5p were predicted by 5 target prediction databases; hsa-miR-574-3p was predicted from 4 target prediction databases, and hsa-miR-466 and hsa-miR-3613-3P were predicted from 2 target prediction databases (Table 3). [score:7]
Finally, we selected 5 miRNAs for further analysis: 3 were upregulated in the AF group relative to the NSR (hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p), and 2 were downregulated (hsa-miR-1 and hsa-miR-26a-5p). [score:7]
According to the RT-qPCR data, hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p were upregulated in the LAAs of the AF group relative to the NSR, while hsa-miR-1 and hsa-miR-26a-5p were downregulated. [score:7]
Spearman’s correlation analysis showed a positive correlation between the level of expression of miR-466 and LA size, and a negative correlation between the level of expression of miR-1 and miR-26a-5p with LA size. [score:5]
To determine the probable biological function of the differentially expressed miRNAs, we predicted the putative targets and pathways of 5 validated miRNAs (hsa-miR-1, hsa-miR-26a-5p, hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p) using the miRFocus database. [score:5]
Recently, Luo et al. [28] found that miR-26 family members were significantly downregulated (>50%) in LAAs from a canine AF mo del (miR-26a) and in right atrial appendages from AF patients (miR-26a and miR-26b). [score:4]
030hsa-miR-21-5p442.29819.400.890.047hsa-miR-44974574.246545.730.520.047Downregulated*hsa-miR-26a-5p9701.874313.64-1.170.007hsa-miR-112740.133079.47-2.050.019hsa-miR-195-5p611.70384.70-0.670.022hsa-miR-26b-5p794.41198.33-2.000.023hsa-miR-5100775.16362.75-1.100.029hsa-miR-29a-3p589.33512.76-0.200. [score:4]
A recent study identified miR-26 as a potentially important regulator of KCNJ2 gene expression and, via I [K1], a determinant of AF susceptibility [28]. [score:4]
Moreover, there was a significantly negative correlation between the levels of expression of miR-1 and miR-26a-5p in LAAs and LA size (r = –0.81; P = 0.002 and r = –0.86; P < 0.001, respectively). [score:3]
Our study found that the expression levels of three validated miRNAs (miR-1, miR-26a-5p, miR-466) correlated with LA size, while those of two others (miR-574-3p, miR-3613-3p) did not. [score:3]
This suggests the possible involvement of these miRNAs in AF pathophysiology, and is consistent with our finding that miR-26a-5p was downregulated in LAA tissues from MS patients with AF compared with those who remained in NSR. [score:3]
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (miR-1, miR-26, miR-328) [10, 27, 28] or structural remo deling (miR-30, miR-133, mir-590) [7, 30]. [score:3]
Although the fold change of hsa-miR-26a-5p did not meet this criteria (|log [2] [(fold change)]| = 1.17), its P -value was <0.01, and thus it was included in our selection. [score:1]
Although the fold change of miR-26a-5p (|log [2] [(fold change)]| = 1.17) does not meet the criteria, its P-value is <0.01 (i. e., –Log [10](P-value) > 2), and therefore is also labeled red. [score:1]
In addition, it also identified miR-26 as a potential mediator of the electrophysiological effects of Ca [2+] -dependent NFAT (nuclear factor of activated T cells) signaling, believed to be important in the perpetuation of AF. [score:1]
[1 to 20 of 16 sentences]
16
[+] score: 60
The down-regulation of plasma miR-26a expression may indicate the probability of diagnosing GC. [score:6]
They also demonstrated that miR-26a inhibited tumor growth and metastasis partly by targeting FGF9 in vivo. [score:5]
In summary, our study revealed four down-regulated miRNAs, miR-148a, miR-142-3p, miR-26a, and miR-195, in GC patients. [score:4]
Ultimately, four down-regulated plasma miRNAs (i. e., miR-26a, miR-142-3p, miR-148a and miR-195) were selected as the candidates for the fist-stage validation (Table 2). [score:4]
The plot showed that the expression levels of four miRNAs were statistically significant in the GC tissues (P = 0.001, P = 0.002, P < 0.001 and P = 0.003 for miR-26a, miR-142-3p, miR-148a and miR-195, respectively, Figs 2A–2D). [score:3]
The cutoff value of 0.651 was equal to sensitivity + specificity-1 which was maximal for miR-26a (relative expression normalized by cell-39). [score:3]
More importantly, the plasma expression of miR-26a was significantly reduced and stable in patients with gastric cancer. [score:3]
Furthermore, the expression level of miR-26a in plasma was significant lower in the GC patients, and didn’t show any significance with the progression of GC (S3 Fig). [score:3]
0151345.g002 Fig 2(A-D) Relative expression levels of miR-26a, miR-142-3p, miR-148a, miR-195, in 50 paired gastric cancer tissues and corresponding noncancerous tissues (log [10] scale on Y -axis). [score:3]
Furthermore, we found that the miR-26a expression significantly reduced in GC patients and kept stable in the plasma (S3 Fig). [score:3]
The results revealed that the plasma expression of miR-26a was significant lower in the GC patients compared with the healthy controls (P < 0.05), which showed stability in GC patients with different clinical status. [score:2]
For miR-26a, the sensitivity was 83.6% and the specificity was 81.5% with an AUC of 0.882 (95% CI = 0.847–0.916) (Fig 4A). [score:1]
ROC curves were constructed to show AUCs of miR-26a (A), miR-142-3p (B), miR-148a (C), miR-195 (D) and the combination of four miRNAs (E). [score:1]
Comparing TLDA analysis and the result of tissue microarray, four miRNAs(miR-26a, miR-142-3p, miR-148a and miR-195) reduced in GC were selected. [score:1]
S1 Fig The combination of miR-26a and miR-142-3p (A), the combination of miR-26a and miR-148a (B), the combination of miR-26a and miR-195 (C), and the combination of miR-142-3p and miR-148a (D), the combination of miR-142-3p and miR-195(E) and the combination of miR-148a and miR-195 (F) yielded the largest AUCs. [score:1]
In the current study, ROC analysis indicated that the combination of four miRNAs wasn’t more effective than miR-26a individually. [score:1]
Box plots showed the plasma levels of miR-26a (A), miR-142-3p (B), miR-148a (C) and miR-195 (D) in 200 gastric cancer patients and 200 age- and gender-matched healthy controls. [score:1]
These findings confirmed that miRNA-26a in plasma could be a potential diagnostic marker for GC. [score:1]
S2 Fig The combination of miR-26a, miR-142-3p and miR-148a (A), the combination of miR-26a, miR-142-3p and miR-195 (B), the combination of miR-26a, miR-148a and miR-195 (C) and the combination of miR-142-3p, miR-148a and miR-195 (D) yielded the largest AUCs. [score:1]
These were far less than the sensitivity of miR-26a. [score:1]
As a result, miR-26a may provide a non-invasive and stable biomarker of gastric cancer diagnosis and screening. [score:1]
Hence, miR-26a had great potential as a diagnostic plasma biomarker for GC. [score:1]
S3 Fig Box plots showed the plasma levels of miR-26a in 200 healthy controls and 200 gastric cancer patients at different clinical status. [score:1]
Our study indicated that miR-26a was significantly decreased stably in plasma of gastric cancer patients and could distinguish gastric cancer patients from controls, with good sensitivity and specificity. [score:1]
Zhang et al. found that miR-26a induced endothelial apoptosis and indicated a therapeutic potential of miR-26a for atherosclerosis associated with apoptotic cell death [7]. [score:1]
Plasma miR-26a may provide a novel and stable marker of gastric cancer. [score:1]
Plasma level of miR-26a in gastric cancer patients stratified by the clinical status. [score:1]
Therefore, miR-26a may be a best choice to serve as potential biomarker for GC. [score:1]
0151345.g004 Fig 4 ROC curves were constructed to show AUCs of miR-26a (A), miR-142-3p (B), miR-148a (C), miR-195 (D) and the combination of four miRNAs (E). [score:1]
0151345.g003 Fig 3Box plots showed the plasma levels of miR-26a (A), miR-142-3p (B), miR-148a (C) and miR-195 (D) in 200 gastric cancer patients and 200 age- and gender-matched healthy controls. [score:1]
To verify the diagnosis value of the host miRNA for GC, we combined any of the plasma miRNAs and performed the ROC curves as shown in S1 and S2 Figs. These data indicated that the miR-26a which showed the greatest ability for differentiating the GC patients from controls, could act as a suitable biomarker for detecting GC. [score:1]
Deng et al. showed that miR-26a levels in GC tissues were more remarkably decreased than those in non-tumor tissues by qRT-PCR [40]. [score:1]
[1 to 20 of 32 sentences]
17
[+] score: 57
Inhibition of miR-26a caused downregulation of the PAX2 expression whereas upregulation of miR-26a increased its expression by almost 3 fold (Figure 4C). [score:13]
We observed PAX2, a transcription factor, to be significantly upregulated upon influenza infection and its expression could be modulated by regulating miR-26a. [score:7]
Interestingly anti miR-26a suppressed PAX2 expression suggesting that miR-26a is crucial for PAX2 expression. [score:7]
On the contrary, the expression of downregulated miRNAs (miR-26a and miR-628-3p) differed in exosomes in comparison to cells. [score:6]
Albeit the weak binding interactions, among the 12 miRNAs, miR-26a, -576-3p and -628-3p were predicted to target influenza A H1N1 only whereas the remaining 9 miRNAs were predicted to target both (H1N1 and H3N2) influenza genomes. [score:5]
miR-576-3p was not detectable in exosomes, while miR-26a and miR-628-3p were upregulated in exosomes. [score:4]
We studied the effects of modulating miR-26a, -576-3p and -628-3p using respective inhibitors and mimics on several of these predicted genes. [score:3]
Similar to miR-26a: PAX2, miR-628-3p was observed to be an activator of DLG5 expression. [score:3]
This observation was further strengthened when an increase in PAX2 expression was seen in increased miR-26a levels. [score:3]
Although weak binding interaction were seen and their relevance to regulating viral transcripts is yet to be established miR-26a, -576-3p and -628-3p were shown to be specific for H1N1. [score:2]
In contrast, clustalw alignment, based on different strains (JX309814_A/ Singapore/TT454/20; CY064730A/MexicoCity/022/2009; CY045232A/Taiwan/126/2009, CY091235A/Singapore/NHRC0012; EF554793A/Ohio/ 2006; CY121798A/Brisbane/11/2010) showed that the sequences in the predicted regions for miR-26a, -576-3p and -628-3p between influenza A H1N1 and influenza A H3N2 were highly similar with single nucleotide mutations within the seed regions (Figure 2). [score:2]
These findings suggest that miR-26a plays a crucial role in activating PAX2. [score:1]
The anti miRNAs and miRNA mimics used in this study are commercially available (Anti/Mimic miR-26a (MH/MC10249), Anti/Mimic miR-576-3p (MH/MC13069), Anti/Mimic miR-628-3p (MH/MC12299); Ambion, USA). [score:1]
[1 to 20 of 13 sentences]
18
[+] score: 56
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
Target mRNA of miR-26a is the transcription factor SMAD1, which is involved in the regulation of bone morphogenic protein signalling during lung development and pulmonary vascular remo delling [73, 74]. [score:5]
Another member of miRNA family, miR-26a, has been shown to be selectively expressed in the bronchial and alveolar epithelial cells in murine lung [72]. [score:3]
Several miRNAs such as miR-155, miR-26a, let-7, miR-29, miR-15/miR-16, miR-223, miR-146a/b and the miR-17-92 cluster have been shown to be involved in homeostasis and in the lung development (Table 4). [score:2]
Thus, miR-26a might be important in controlling essential developmental and physiological events in the lung [75]. [score:2]
[1 to 20 of 6 sentences]
19
[+] score: 56
We noted that miRNAs (miR-328-5p, miRNA-26a, hsa-miR-4654, miR-4707-5p, miR-4487, miR-24-3p, miR-6824-5p, miR-4740-5p, miR-8074 and, miR-146a-5p) down-regulated in females with OA have a number of TLR related target genes as per miRNA target prediction software’s (targetscan, miRwalk2.0 and microRNA. [score:10]
Estrogen inhibitor (Letrozole) down-regulates (a) miR-26a-5p, (b) miR-146a-5p, (c) miR-328-5p, (d) miR-4654 and up-regulated (e) miR-7107-5p in EVs cargo of human synovial fibroblast cells. [score:9]
In female samples, we found that miR-16-2-3p (p =  0. 085) up-regulated and miR-26a-5p (p =  0. 01), miR-146a-5p (p =  0. 01830) and miR-6821-5p (p =  0. 017) down-regulated. [score:7]
For example, miRNA-26a targets TLR3 and miR-146a-5p targets three TLR signaling genes (two sites on TLR9, TLR106, TRAF6 and one each on TLR2, and IRAK1). [score:5]
Some of the miRNAs showing differential expression in OA, (such as miR-146a, miR-26a, and miR-210) had previously been associated with cartilage pathophysiology and other musculoskeletal diseases 36– 40. [score:5]
The miRNAs (miR-24-3p, miR-26a-5p, miR-200a-3p) down-regulated in female OA samples are known to be elevated with estrogen treatment 51, 52, 55– 57. [score:4]
Our results show that aromatase inhibitor treatment decrease content of miR-26a-5p, miR-146a-5p, miR-328-5p, miR-4654, and increased miR-7107-5p in EVs cargo. [score:3]
Rasheed Z Al-Shobaili HA Rasheed N Mahmood A Khan MI MicroRNA-26a-5p regulates the expression of inducible nitric oxide synthase via activation of NF-κB pathway in human osteoarthritis chondrocytesArch Biochem Biophys. [score:3]
Real-time PCR validation showing change in miRNA expression in female samples [n = 9 (NON-OA) and n = 16–18 (OA)] (a) miR-16-2-3p (p = 0.085), (b) miR-6821-5p (p = 0.017), (c) miR-26a-5p (p = 0.01), and d) miR-146a-5p (p = 0.01830) and e) miR-210-5p (p = 0.2033) and f) miR-6878-3p (p = 0.0823) in male samples [n = 9 (NON-OA) and n = 15 (OA)]. [score:3]
Jiang, C. et al. MicroRNA-26a negatively regulates toll-like receptor 3 expression of rat macrophages and ameliorates pristane induced arthritis in rats. [score:3]
Our results show that treatment with an aromatase inhibitor significantly decreases content of miR-26a-5p (p < 0.01), miR-146a-5p (p < 0.07), miR-328-5p (p < 0.01), and miR-4654 (p < 0.01) (Fig.   6). [score:3]
Real-time PCR was performed on randomly selected miRNAs (miR-6878-3p, miR-210-5p, miR-16-2-3p,miR-26a-5p, miR-146a-5p and miR-6821-5p) to validate miRNA array data in age matched male (NON-OA, n = 9 and OA, n = 15) and female donor samples (NON-OA, n = 9 and OA, n = 16-18). [score:1]
[1 to 20 of 12 sentences]
20
[+] score: 51
We and others have recently demonstrated that miR-26a possessed the tumor-suppressive functions by directly targeting the EZH2 oncogene in cancers e. g. nasopharyngeal carcinoma [30], lymphoma [60] and HBV -associated HCC cells (Figure S3). [score:6]
For example, viral -mediated administration of miR-26a in a mouse mo del of HCC resulted in inhibition of cancer cell proliferation, induction of tumor-specific apoptosis, and dramatic protection from disease progression [31]. [score:5]
This notion is further supported by findings from large cohorts of HBV -associated HCCs demonstrating that patients whose tumors had low miR-26a expression had shorter overall survival than those with high tumor miR-26a expression [64]. [score:5]
Interestingly, strong enrichment of HBx was detected in 6 HBxΔ35-down-regulated miRNAs (miR-26a, -29c, -30d, -190, -210 and -574) proximal to their transcription start sites (±1.5 kilo-base) in HBxΔ35 -expressing MIHA hepatocytes compared with vector control (Figure 4A and data not shown). [score:5]
Figure S3 Effect of ectopic miR-26a over -expression on EZH2 expression in PLC5 HBV associated HCC cell line. [score:5]
These data suggested that miR-26a post-transcriptionally suppressed EZH2 expression in HCC cells. [score:5]
As HBx is frequently integrated into the host genome in truncated form and over-expressed in HBV -associated HCC [10]– [13], Ct-HBx -mediated transcriptional repression may be one of the reasons underlying the reduced expressions of miR-26a and -29c in HCC cells (Table 2 and Figure S1). [score:5]
To establish a direct link between Ct-HBx and transcriptional control of miRNA expression, we cloned the promoter regions of 2 repressed miRNAs (miR-26a and miR-29c) that contained the Ct-HBx binding sites (Figure 4A) into luciferase reporter and then co -transfected with HBxΔ35, full-length HBx or empty vector for promoter activity assays. [score:3]
Notably, some of the examined repressed-miRNAs (miR-26a, -29c, -146a and -190) were also significantly down-regulated in a subset of HCC tissues with carboxyl-terminal HBx truncation compared to their matching non-tumor tissues, highlighting the clinical relevance of our data. [score:3]
We then examined the expression levels of some of the HBxΔ35-repressed miRNAs (miR-26a, miR-29c, -146a and -190) in the clinical specimens using TaqMan -based real-time PCR. [score:3]
Therefore, Ct-HBx might promote HCC development via the deregulation of miR-26a control on the EZH2 epigenetic machinery [63]. [score:3]
We demonstrated that the expression levels of miR-146a and -190, along with miR-26a and -29c, were significantly lower in HCCs compared to the matching non-tumor tissues (Figure 5). [score:2]
Hsa-miR-26a and negative control miRNA mimics were purchased from Ambion (Austin, TX, USA). [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 50
Carrier DiseaseTarget miRNA (s) and role in cancer Viruses Adeno -associated viruses(AAV8)Hepatocellular cancer miR-26 tumor suppressor[140] Adenoviruses Lung cancer let-7 tumor suppressor[141] Adenoviruses Glioblastoma miR-145 tumor suppressor [144] Adenoviruses Glioblastoma miR-221-222 oncogene[145] Lentiviruses Prostate cancer miR-15-16 tumor suppressor[142] Lentiviruses Pancreatic cancer miR-21 oncogene [143] Lipid -based nanoparticles Cationic liposomes Breast cancer miR-34a tumor suppressor[124] Cationic liposomes Pancreatic cancer miR-34a, miR-143-145 tumor suppressors[146] Neutral lipid emulsion © Lung cancer miR-34a, let-7 tumor suppressors[147] Stable nucleic acid lipid particles Glioblastoma miR-21 oncogene[148] Polymer -based nanoparticles Polyurethane Glioblastoma miR-145 tumor suppressor[149] Poly(lactic-co-glycolic acid) Lymphoma miR-155 oncogene[96] Polyamidoamine Glioblastoma miR-21 oncogene[150] Viral vectors have also been applied in miRNA -based therapeutic strategies towards GBM. [score:21]
Carrier DiseaseTarget miRNA (s) and role in cancer Viruses Adeno -associated viruses(AAV8)Hepatocellular cancer miR-26 tumor suppressor[140] Adenoviruses Lung cancer let-7 tumor suppressor[141] Adenoviruses Glioblastoma miR-145 tumor suppressor [144] Adenoviruses Glioblastoma miR-221-222 oncogene[145] Lentiviruses Prostate cancer miR-15-16 tumor suppressor[142] Lentiviruses Pancreatic cancer miR-21 oncogene [143] Lipid -based nanoparticles Cationic liposomes Breast cancer miR-34a tumor suppressor[124] Cationic liposomes Pancreatic cancer miR-34a, miR-143-145 tumor suppressors[146] Neutral lipid emulsion © Lung cancer miR-34a, let-7 tumor suppressors[147] Stable nucleic acid lipid particles Glioblastoma miR-21 oncogene[148] Polymer -based nanoparticles Polyurethane Glioblastoma miR-145 tumor suppressor[149] Poly(lactic-co-glycolic acid) Lymphoma miR-155 oncogene[96] Polyamidoamine Glioblastoma miR-21 oncogene[150]Viral vectors have also been applied in miRNA -based therapeutic strategies towards GBM. [score:21]
The systemic administration of an AAV8 encoding miR-26a, which is highly downregulated in hepatocellular cancer and induces cell cycle arrest by targeting the cyclins D2 and E2, resulted in inhibition of cancer cell proliferation, induction of tumor-specific apoptosis and significant tumor regression, without toxicity [140]. [score:8]
[1 to 20 of 3 sentences]
22
[+] score: 44
Recently, significant downregulation of miR-26a was also reported in nasopharyngeal carcinoma tissues and cell lines (53); its ectopic expression has been shown to downregulate EZH2 expression, thereby inducing G [1]-phase cell-cycle arrest to decrease cell proliferation and colony formation (53). [score:11]
The expression of miR-223, miR-483-3p (p-value = 0.01), 146b, 205 (p-value = 0.001), 221, 21 (p-value = 0.023), 195, 34c and miR-26a (p-value = 0.0078) were significantly upregulated, whereas the expression of miR-216, miR-141, miR-217, Let-7b (p-value = 0.001), and Let-150 (p-value = 0.01) were significantly downregulated in human PC tissues as compared to the cancer-adjacent normal tissues (Figure 3E). [score:10]
The panel of differentially expressed miRNAs were validated by real-time PCR using TaqMan assays, and the results were consistent with the data that showed up-regulation of miR-21, miR-221, miR-100 and miR-26a and down-regulation of miR-26b, miR-141, miR-96, miR483-3p, miR-216, and miR-217 in the KC compared to control mice (Figure 1A). [score:7]
Accordingly, we observed significant downregulation of miR-26a in KC mice at 50 weeks of age, although it was upregulated at 25 weeks in KC mice and in human PC tissues compared to normal tissues (Figure 2B, 2D and 3E). [score:6]
Further, at 50 weeks of age, the expression of miR-216, miR-217, miR-345, miR-141, miR-483-3p, miR-26b, miR-96, Let-7b (p-value = 0.01), miR-100, miR-26a and miR-150 (p-value = 0.094) were further downregulated in KC animals compared to control mice (Figure 2D). [score:5]
The miR-26a miRNA inhibits the expression of c-myc, Cyclin D3 and E2, and cyclin -dependent kinases such as CDK4 and CDK6. [score:5]
[1 to 20 of 6 sentences]
23
[+] score: 44
These tumor suppressors were targeted by multiple upregulated miRNAs (miR-19b-3p, miR-26a-5p, miR-30b-5p, miR-92a-5p and miR-27b-3p) which could account for their aberrant expression in eBL. [score:10]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Upregulation of miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) in eBL targeting ATM suggests abnormal miRNA mediate regulation of this gene which would lead to ATM loss. [score:7]
Genomic aberrations such as abnormal upregulation of host miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) targeting ATM would favor proliferation, tumor cell survival and occurrences of mutations that would favor oncogenesis. [score:7]
It is possible that during tumorigenesis a number of GC B cells have low ATM levels due to small interfering RNA -mediated regulation, as a result of irregular expression of miR-27b-3p, miR-26a-5p, miR-30b-5p and myc -dependent activation of miR-17~92 cluster miRNAs. [score:4]
[1 to 20 of 6 sentences]
24
[+] score: 39
miRNA Protein target(s) Regulatory Action Clinical Implications miR-1 LXRα*Directly suppresses LXR in vitro May promote an increase in cellular cholesterol[38] miR-9 ACAT1* Directly suppresses ACAT1 and esterification of cholesterol in macrophages Overexpression may promote macrophage cholesterol efflux and reduce foam cell formation[47] miR-10b ABCA1* ABCG1* Directly represses ABCA1 and ABCG1 expression and decreases macrophage cholesterol efflux Can be suppressed by dietary anthocyanins, leading to increased macrophage cholesterol efflux and lesion regression[63] miR-19b ABCA1* Directly suppresses ABCA1 and decreases cholesterol efflux to ApoA1; increases atherosclerotic lesion area and severity Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[53] miR-26 ABCA1* ARL7 Activated by LXR to suppress both proteins, decreasing macrophage cholesterol efflux Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[58] miR-27a/b ABCA1* ABCG1 ACAT1* CD36 LPL* Directly suppresses ABCA1, indirectly suppresses ABCG1, and reduces cholesterol efflux. [score:32]
LXR activation in vitro decreases the expression of miR-26 [58], reversing miR-26 -mediated suppression of ABCA1 and ADP-ribosylation factor-like 7 (ARL7), the transporter that carries cholesterol to the membrane to facilitate association with ABCA1 [59]. [score:5]
Sun D. Zhang J. Xie J. Wei W. Chen M. Zhao X. MiR-26 controls LXR -dependent cholesterol efflux by targeting ABCA1 and ARL7 FEBS Lett. [score:2]
[1 to 20 of 3 sentences]
25
[+] score: 39
On the other hand, miR-138 expression was significantly higher in tumor than in normal tissues and miR-26a and miR-124 expression was comparable between the two types of tissues. [score:5]
On the other hand, it was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 could inhibit the expression of EZH2 in some tumors. [score:5]
On the other hand, expression of miR-138 was significantly higher in tumor tissues than in matched normal tissues (Figure 2D) and the expression levels of miR-26a and miR-124 were not significantly different between tumor and matched normal tissues (Figure 2E and F). [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 inhibit the expression of EZH2 in nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma, respectively [21- 26]. [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 were involved in the regulation of EZH2 expression in some human tumors such as nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma [21- 26]. [score:4]
MiR-26a, miR-98, miR-101, miR-124,miR-138 and miR-214 were reported to be decreased in some human tumors and posttranscriptionally regulate the expression of EZH2 [21- 26]. [score:4]
Considering that the expression and function of miRNAs may vary in different types of tumors, here we set out to investigate whether these miRNAs (miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214) regulate tumor metastasis via altering EZH2 expression in human ESCC. [score:4]
showed that the expression of miR-98 (A), miR-101 (B) and miR-214 (C) were significantly decreased in tumor tissue compared with the matched normal tissue; while that of miR-138 (D) was significantly increased in tumors tissue, and there was no significantly difference in the expression of miR-26a (E) and miR-124 (F) between the two groups. [score:4]
In the present study, we first examined the expression levels of MiR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 in clinical samples of ESCC and matched normal tissues using qPCR. [score:3]
[1 to 20 of 9 sentences]
26
[+] score: 37
When miR-26a expression is silenced, resulting in cell cycle arrest in G [1] phase, PRKCD expression is low and CCNE expression is increased; however, caspase 3/7-regulated apoptosis is not affected [10]. [score:8]
In summary, miR-26a is involved in the G [1]/S transition mechanism in PA cells, perhaps though inhibiting PRKCD expression and promoting CCNE expression. [score:7]
PRKCD is a target gene of miR-26a, which inhibits mRNA translation of PRKCD. [score:7]
Low expression of miR-15a, miR-16, miR-26a, and miR-196a in PAs could increase the expression of their target genes HMGA1 and HMGA2. [score:7]
Let-7 [9], miR-26a [10], miR-34a [11], miR-15a/ 16 [12], and miR-503 [11] are differentially expressed in PAs compared with normal tissues, and CCND1 has been predicted to be a potential target [13, 14]. [score:4]
MiR-26a [10] is highly expressed in ATCH adenoma, with PRKCD as the target gene. [score:4]
[1 to 20 of 6 sentences]
27
[+] score: 37
TargetScan and PicTar analysis showed that miR-26a showed target for collagen type I and CTGF gene and miR-451 showed target for titin which are markers for pro-fibrotic process. [score:7]
0064396.g003 Figure 3 A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
Targetscan analysis showed that miR-26a and miR-29c had target genes for collagens which involved in pro-fibrotic events and fibrosis. [score:5]
Our study reveals that in human subjects with moderate to severe PH are associated with significant downregulation of plasma levels of circulatory miR-1, miR-26a and miR-29c. [score:4]
MiR-1, miR-26a, miR-29c, miR-34b, miR-451 and miR-1246 are downregulated in PH subjects. [score:4]
The expressions of miR-26a, miR-29c, miR-451 and miR-1246 were declined to 0.66±0.12, 0.52±0.14, 0.49±0.16 (p<0.05) and 0.67±0.21-folds (p = ns) respectively, in moderate PH subjects, compared to the control subjects. [score:2]
Alternatively, the significant decrease of miR-1, miR-26a and miR-29c level in PH has potential diagnostic significance. [score:1]
We choose the following miRNAs for validation:MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
We choose the following miRNAs for validation: MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
On the contrary, our data revealed a set of declined miRNAs which includes miR-26a, miR-29c, miR-34b and miR-451and; can be used as biomarker as well. [score:1]
The miR-26a did not show any significant pattern of changes between male and female subjects. [score:1]
[1 to 20 of 12 sentences]
28
[+] score: 36
For the four miRNAs (miR-26a, miR-24, miR-26b, and miR-142-3p) chosen from the class of up-regulation in adults, their expression patterns were also confirmed by showing up-regulation (P < 0.0001) in the adults as compared to the preterm infants and the children, with three of them (miR-26a, miR-26b, and miR-24) being down-regulated from infancy to childhood (Fig. 3B). [score:11]
For the four miRNAs (miR-26a, miR-24, miR-26b, and miR-142-3p) chosen from the class of up-regulation in adults, their expression patterns were also confirmed by showing up-regulation (P < 0.0001) in the adults as compared to the preterm infants and the children, with three of them (miR-26a, miR-26b, and miR-24) being down-regulated from infancy to childhood. [score:11]
Fourth, miR-26a, miR-24, miR-26b, miR-410, and miR-107 were down-regulated from infancy to children, up-regulated in young adulthood, and then showed expression diminishing with aging (Fig. 4D). [score:9]
Six (miR-1, miR-486, miR-26a, miR-24, miR-26b, and miR-142-3p) of seven top 5% differentially expressed miRNAs in the classes with age-limited or age-related expression were confirmed in a validation set using qPCR. [score:5]
[1 to 20 of 4 sentences]
29
[+] score: 34
In the current study, IL-17 producing T cells were expanded from PBMCs from healthy volunteers and the expression pattern of miRNAs in the differentiation of IL-17 producing cells was analyzed by using a. This demonstrated that let-7a, miR-26a, 146a,b, 150, and 155 were significantly upregulated in the differentiation of IL-17 producing cells. [score:6]
The expression level of miR-26a, miR-146a/b, miR-150 and miR-155 in RA patients were significantly higher than in healthy subjects. [score:3]
There were no significant differences between RA and OA patients in the expression level of miR-26a, miR-146b. [score:3]
B., quantitative PCR analysis to examine the relationship between the expression level of Let-7a, miR-26a, 146a/b, 150, and 155 and IL-17 in RA patients. [score:3]
However, there were no significant differences between RA and OA patients in the expression level of miR-26a, miR-146b. [score:3]
RA patient PBMCs exhibit increased expression of Let-7a, miR-26a, 146a,b, 150, and 155. [score:3]
miRNA Targets Referances let7a Lin-41, Hbl-1, RAS, TRIM71[41], [42], [43], [30], [44] miR-26a Ezh2, GSK-3β、[45], [46] miR-146a/b TRAF6, IRAK1,IRAK2[47], [48] miR-150 c-Myb[49] miR-155 FADD, IKK, Ripk1, TAB2, PU. [score:3]
A, A quantitative PCR analysis of the expression of let-7a, miR-26a, 146a,b, 150, and 155 in expanded IL-17 producing T cells and non-expanded cells. [score:3]
Six miRNAs, let-7a, miR-26, miR-146a/b, miR-150, and miR-155 were significantly up regulated in the IL-17 producing T cells. [score:2]
The expression of let-7a, miR-26a, 146a,b, 150, and 155 between expanded IL-17 producing T cells and non-expanded cells was compared by using real-time PCR to confirm the results of microarray analysis. [score:2]
miR-155 showed a 9-fold increase, and miR-26a showed the smallest increase. [score:1]
The expansion of miR-155 was the greatest (9-fold), and the lowest was miR-26a (Figure 1A). [score:1]
The six miRNAs were miR-26a (1.81 fold; p = 0.029), 146a (1.43 fold; p = 0.040), 146b (1.80 fold; p = 0.040), 150 (1.61 fold; p = 0.040), 155 (2.03 fold; p = 0.007) and let-7a (2.12 fold; p = 0.012; Table 2). [score:1]
[1 to 20 of 13 sentences]
30
[+] score: 33
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Interestingly, miR-26a has been shown to directly down-regulate IFN-β, a major cytokine involved in innate and adaptive immune responses, suggesting a potential role for this miRNA as an immuno-suppressor during early pregnancy [46]. [score:7]
RT-qPCR validation using the same plasma samples confirmed that miR-26a was differentially upregulated on Day 16 pregnant relative to non-pregnant heifers (1.7-fold; P = 0.043), whereas miR-1249 tended to be upregulated in Day 16 pregnant heifers (1.6-fold; P = 0.081). [score:7]
NP corresponds to plasma samples collected before insemination (Day 0) from the same animalsAlthough expressed ubiquitously, distinctly high levels of miR-26a have been reported in the embryo, the ovary, and immune-related tissues and cells such as the thymus and B/T cells of different species [42– 45]. [score:3]
NP corresponds to plasma samples collected before insemination (Day 0) from the same animals Although expressed ubiquitously, distinctly high levels of miR-26a have been reported in the embryo, the ovary, and immune-related tissues and cells such as the thymus and B/T cells of different species [42– 45]. [score:3]
Also, high plasma miR-26a levels have been associated with pre-eclampsia in humans [49]. [score:1]
These findings support the notion that miR-26a is involved in pregnancy, possibly by exerting immunomodulatory effects. [score:1]
Thus, from analyses in two independent groups of animals we concluded that the levels of miR-26a increase during early pregnancy in heifers. [score:1]
We have identified miR-26a as a potential circulating biomarker of early pregnancy. [score:1]
To more robustly validate the changes in miR-26a during early pregnancy, particularly as they were relatively small, we analysed plasma samples from a different, larger group of heifers during early pregnancy (Fig.   6c). [score:1]
Further validation in an independent group of heifers confirmed an increase in plasma miR-26a levels during early pregnancy, which was significant only on Day 24 (2.0-fold; P = 0.027). [score:1]
Additionally, recent studies in pig and goat have reported increasing levels of miR-26a in the conceptus and the ovary as early as Day 20 of pregnancy [47, 48]. [score:1]
On average, miR-26a levels were also higher on Day 16 (1.7-fold) although this difference did not reach significance (P = 0.118). [score:1]
Specifically, we identified an increase (up to 2-fold) in the levels of miR-26a during Days 16 to 24 of pregnancy. [score:1]
For 9 of these differences (Fig.   6a) the results of qPCR were consistent with those obtained by PCR array or sequencing although significance was only obtained for miR-26a; an increase in the levels of this miRNA was significant on Day 16 (NP vs P16, 1.7 fold, P = 0.043) but not on Day 24 (1.7 fold, P = 0.208 Fig.   6b). [score:1]
b RT-qPCR data plots (with mean ± SEM) for selected comparisons between pregnant and non-pregnant groups including the two differences in miRNA abundance that were significant (miR-26a, * indicates P < 0.05) or tended to be significant (miR-1249, NP vs P16, P < 0.1). [score:1]
In summary, our results identify miR-26a as a novel candidate biomarker of early pregnancy in cattle. [score:1]
c RT-qPCR data plots (with mean ± SEM) obtained from an independent group of heifers and which confirms an increase in plasma miR-26a levels during early pregnancy. [score:1]
[1 to 20 of 17 sentences]
31
[+] score: 31
It is however interesting to note that several miRNAs in addition to miRNA-210 i. e., miR-23, miR-24, miR-26a, miR-26b, miR-29a and miR-107 up-regulated through time course infection in our study were described as hypoxia-related [77], [78], negatively regulating HIF-1α through factor inhibiting-HIF-1α (FIH) [79] or induced by this TF [80]. [score:7]
In order to check if the mRNA expression of these chemokines was negatively correlated with the up-regulation of all the corresponding targeting miRNAs (i. e., let-7a, miR-25, miR-23b, miR-26a, miR-132, miR-140, miR-146a, miR-146b, miR-155 and miR-210) identified in Table S2, we measured their levels using qRT-PCR. [score:6]
Figure 3 shows the relative expression levels of let-7a, miR-25, miR-26a, miR-132, miR-140, miR-146a and miR-155 at 3 and 6 h (panel A), and of five chemokines of their predicted targets at 12 and 24 h (panel B). [score:5]
Based on the observation that five chemokines (CCL2, CCL5, CXCL10, CXCL11 and CXCL12) are targeted by L. major-regulated miRNAs i. e., Let-7a, miR-25, miR-26a, miR-132, miR-140, miR-146a and miR-155, we show a negative correlation of transcript abundance with their corresponding miRNAs. [score:4]
Expression means of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3; panel A) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA mean levels at 12 and 24 h post-infection (panel B) in L. major-infected human macrophages. [score:3]
0002478.g003 Figure 3Expression means of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3; panel A) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA mean levels at 12 and 24 h post-infection (panel B) in L. major-infected human macrophages. [score:3]
Expression of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA levels at 12 and 24 h post-infection in L. major-infected human macrophages. [score:3]
[1 to 20 of 7 sentences]
32
[+] score: 31
b The short peptide, ERAP, and the natural product derived from medical plants, xanthohumol, could disrupt the PHB2/BIG3 interaction directly and lead to the translocation of PHB2 from cytoplasm to nucleus, thereby, induce cell growth arrest in some estrogen -dependent cancers a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:8]
Fig. 4 a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:7]
In glioma cells, PHB1 expression is down regulated by miR-26a, which interferes with the regulation of PHB1 on expression levels of HIF-1 and VEGF, as well as tumor growth 65, 66. [score:7]
Interestingly, miR-26a also binds directly to the 3′-UTR of PHB1, inhibiting its expression in glioma cells [66]. [score:6]
Qian X MicroRNA-26a promotes tumor growth and angiogenesis in glioma by directly targeting prohibitinCNS Neurosci. [score:3]
[1 to 20 of 5 sentences]
33
[+] score: 29
Studies have shown that miR-22 over -expression down-regulates CDK6 in human fibroblasts [37] and miR-26a/b over -expression down-regulates CDK6 in human liver and lung cells [38], which in both cases causes cell cycle arrest in the G1 phase. [score:11]
The overall expression pattern does, however, in both cases still show a gradual increase in miR-26a expression level with maturity and the real-time verification shows an even more pronounced difference in expression between the populations. [score:7]
hsa-miR-26a Both Targetscan and miRanda: CBFB, SP3, MYBL1, SP1, CUX1, Targetscan: CDC6, CDK8, TAB3, RB1, CREBBP. [score:5]
Except for miR-26a (cluster 5) there was a good correlation between the expression profiles determined by microarray analysis and by real-time PCR. [score:3]
miR-26a and miR-22 have a cluster 5 profile and miR-26b has a cluster 6 profile and thus could be implicated in miRNA mediated cell cycle regulation in human granulopoiesis. [score:2]
The miRNAs were miR-130a and miR-155 (cluster 1), miR-146a (cluster 2), miR-34c-3p (cluster 3), miR-99b (cluster 4), miR-183 and miR-26a (cluster 5), and miR-27a and miR-223 (cluster 6). [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 27
The overexpression of miR-26a in tumor cells strongly improved the accumulation of pyruvate and reduced the production of acetyl coenzyme A. At the same time, the inhibition of miR-26a expression developed opposite biological effects [23]. [score:7]
HGF was identified as a target of miR-26a and its activation antagonizes the effects induced by the up-regulation of miR-26a [22]. [score:6]
We have revealed common small non-coding RNA molecules (miR-26a, miR-195, miR- miR-126, miR-122, miR-21, miR-155, miR-9, miR-135b, miR-29b, miR-142-3p, miR-210, miR-181, miR- 224) in HCC and CRC, which suppress the expression of multiple genes involved in tumor- stromal interactions, immune invasion and tumor angiogenesis. [score:5]
Moreover, the miR-26 down-regulation increases the angiogenic potential of these types of cancers. [score:4]
Therefore, miR-26a partially exerted its anti-angiogenesis effect by blocking the HGF-receptor (cMet) and its signaling pathway, thus consequently suppressing VEGFA production in HCC cells and modifying vascular endothelial growth factor receptor 2 (VEGFR2)-signaling in endothelial cells. [score:3]
In multivariate analysis, it was demonstrated that miR-26a, alone or in combination with HGF, is an independent prognostic indicator for time to recurrence and overall survival in HCC patients [22] (Figure 1). [score:1]
In conclusion, HCC patients with low hepatocyte growth factor (HGF), low VEGFA, high miR-26a levels or low microvessel density in tumor cells have a better prognosis with longer overall survival and time to recurrence. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 26
In particular, previous studies showed that miR-26a sensitized gastric cancer to cisplatin targeting NRAS and E [2]F [2] [22], miR-149 increased chemosensitivity of glioblastoma to Temozolomide treatment through a RAP1B -mediated remo deling of cellular cytoskeleton [23], miR-181a enhanced Adryamicin -induced apoptosis targeting Bcl-2 [24], miR-193b sensitized cancer cells to Doxorubicin targeting myeloid cell leukemia-1 (MCL-1) [25], miR-195 increased Adriamycin sensibility by downregulating RAF [26], and, finally, miR-324-3p induced drug sensitivity reducing its SMAD7 target mRNA that is associated with lung, pancreas and skin cancer [27]. [score:12]
Since miR-26a, miR-149, miR-181a, miR-193b, miR-195 and miR-324-3p are resulted to be upregulated (Figure 5) and data in literature showed their involvement in increasing drug sensitivity, we assessed also the expression levels of miR-26a and its potential target E2F2 (Hs00918090_m1) (Supplementary Figure 5). [score:8]
In MDA-MB-231 cells, among upregulated miRNAs there are miR-26a, miR-149, miR-181a, miR-193b, miR-195 and miR-324-3p that increase drug responsiveness. [score:4]
Among miRNAs involved in chemotherapy response, miR-26a, miR-106b, miR-128 and miR-192 were not found significantly deregulated. [score:2]
[1 to 20 of 4 sentences]
36
[+] score: 26
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
Examining a specific KEGG pathway by down-regulation of miR-203, miR-204-5p, miR-205-5p, miR-211-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p in melanoma highlighted the mitogen-activated protein kinase (MAPK) signaling pathway. [score:4]
NS libraries; and for miR-203, miR-204-5p (and its homologue, miR-211-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p down-regulated in PCM vs. [score:4]
NS; and miR-203, miR-211-5p (and its homologue miR-204-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p were down-regulated in PCM vs. [score:4]
For example, miR-205, miR-23b, miR-26a and miR-26b converge on PDGFRA or miR-211 and miR-204 converge on MAPK1, demonstrating a combinatorial effect of miRNAs on the same target. [score:3]
For example, we noted that the most abundant read counts of isomiRs for miR-205, miR-211, miR-15b, miR-26a, miR-203, let-7i, miR-142, miR-150, miR-146a and miR-451a, 6/10 top miRNAs deregulated in the specimens, were not represented as the abundant forms in miRBase (v18). [score:2]
Our previous Sanger sequencing identified 7 of the current top-10 miRNAs: miR-205, miR-211, miR-15b, miR-26a, miR-451a, miR-203 and miR-23b [24]. [score:1]
To elucidate the extent of isomeric differences in melanoma miRNAs, we examined the read counts of isomiRs for miR-205, miR-211, miR-15b, miR-26a, miR-203, let-7i, miR-142, miR-150, miR-146a and miR-451a (Table S7 in file S1). [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 26
Recently, Lu and colleagues reported that miR-26a is commonly downregulated in nasopharyngeal carcinoma (NPC) and functions by repressing EZH2 expression [44]. [score:6]
In addition, the in vitro expression of miR-26 in liver cancer cells induced cell-cycle arrest associated with direct targeting of cyclin D2 [64]. [score:6]
Remarkably, Kota and colleagues found that systemic administration of miR-26a in a mouse mo del of hepatocellular carcinoma resulted in inhibition of cancer cell proliferation, induction of tumor-specific apoptosis, and dramatic protection from disease progression [64]. [score:5]
MicroRNAs miR-26a and miR-26b have also been found downregulated in distinct types of cancer tissue, including squamous cell carcinoma of the tongue [63]. [score:4]
Similarly, our interaction network analysis revealed that cyclin D2 is overtargeted by HNSCC DA including miR-26a/b. [score:3]
As evidenced in Figures 4 and 5, the interaction network approach underscores the key role of let-7a/f, miR-26a/b, miR-103, miR-107, miR-205, and miR-320a/b among others. [score:1]
Regarding to with reduced levels in the circulation of the HNSCC patients, our interaction network analysis underscores the key role of let-7a/f and miR-26a/b, among others. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 24
In particular, induced levels of miR-26a and miR-132 suppress signaling via direct targeting of p300 (32). [score:6]
miR-132 and miR-26a, which were upregulated upon infection, were found to be negative regulators of transcription coactivator p300. [score:5]
These miRNAs, which include miR-26a and miR-142-3p, are pro-apoptotic as their targets include anti-apoptotic genes, for example, members of the BCL2 family (11). [score:3]
For instance, the intracellular pathogen Mycobacterium tuberculosis can modulate expression of miRNAs (e. g., miR-26a and miR-132) to block signaling in M1 MΦ. [score:3]
p300 is part of the signaling cascade, which means that miR-132 and miR-26a are inhibitors of induced signaling. [score:3]
miR-132 and miR-26a were among 31 miRNAs identified by Ni et al. as differentially expressed in primary human MΦs infected with M. tuberculosis (32). [score:3]
However, the following miRNAs are known to be involved in the MΦ response to mycobacterial infection: miR-144 (40), miR-132 (32), miR-26a (32), miR-155 (41), miR-146a (41), miR-145 (41), miR-222 (41), miR-27a (41), miR-27b (41), and miR-125b (42). [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 24
Among miR-26 targets, genes with the highest level of down-regulation were MSMO1 and VMA21. [score:6]
Specifically, Let-7b and miR -28 have been shown to inhibit progesterone and testosterone production in human granulosa cells (GC), while miR-26a and miR-28 suppress estrogen secretion [44– 46]. [score:5]
regulated kinase 1A) 2.0 PPP1R16A (protein phosphatase 1, regulatory subunit 16A) 2.0Among the miRNAs that have been individually shown to be important for both CL function and adiposity, changes in miR-26 and miR-28 were notable. [score:3]
Similarly, expression of let-7b, miR-26a, miR-28 and miR-143 were previously associated with decreased proliferation of GC, while let7b and miR-26a were found to promote GC apoptosis[45– 47]. [score:3]
regulated kinase 1A) 2.0 PPP1R16A (protein phosphatase 1, regulatory subunit 16A) 2.0 Among the miRNAs that have been individually shown to be important for both CL function and adiposity, changes in miR-26 and miR-28 were notable. [score:3]
Published reports suggest that let7b, miR-26a and miR-28 inhibit sex steroid secretion from GC, while let7b, miR-26a, miR-28 and miR-143 decrease GC proliferation and let7b and miR-26a promote GC apoptosis [46]. [score:3]
These included members of the Let 7 family, miR-26a and miR-143, which are among most abundant miRNAs found in mouse, bovine, sheep and human ovaries [40– 43]. [score:1]
[1 to 20 of 7 sentences]
40
[+] score: 23
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
Zhu H. Vishwamitra D. Curry C. V. Manshouri R. Diao L. Khan A. Amin H. M. Npm-alk up-regulates inos expression through a stat3/microrna-26a -dependent mechanismJ. [score:5]
The downregulation of NPM/ALK or STAT3 by siRNA was also associated with a significant increase in miR-26a levels and a marked decrease in levels of the iNOS (Nitric oxide synthase) protein, which promotes lymphocyte survival and protects them from apoptosis [41]. [score:4]
miR-21, miR-26a and miR-219 are also known to be repressed by an NPM/ALK/STAT3 -dependent mechanism, and their targeting could represent another way to improve therapeutic approaches. [score:3]
Restoration of miR-26a in ALK(+) cells was associated with a marked decrease in iNOS protein expression, and this was associated with a reduction in nitric oxide (NO) release and a decrease in viability, adhesion to endothelial cells and migration. [score:3]
MiR-21, miR-26a and miR-219. [score:1]
Moreover, negligible levels of miR-26a were detected in ALK(+) ALCL cell lines (KARPAS-299 and DEL) and tumor samples. [score:1]
[1 to 20 of 7 sentences]
41
[+] score: 23
Notably, miR-26a acts as a tumour suppressor in different types of cancer, such as lymphomas and liver, breast, and nasopharyngeal carcinomas by targeting positive cell cycle regulators [96– 100]. [score:6]
Notably, RBSP3/CTDPSL gene also encodes for miR-26a, a miRNA that, similarly to its host gene, acts as a tumour suppressor in AML by controlling expression of positive cell cycle regulators [41]. [score:6]
Another miRNA repressed by c-Myc in AML is miR-26a, which was found down-regulated in different AML subtypes [95]. [score:4]
In particular, these studies identified miR15/miR-16, miR-26, miR-29, miR-107, miR-142, miR-342, and let7 between the miRNAs significantly induced, whereas miR-181b was found to be downregulated by ATRA. [score:4]
Ectopic expression for some of these miRNAs, such as miR-26a, miR-29a, miR-142-3p and miR-342, has been produced and, similarly to miR-223, it stimulated granulocytic differentiation of AML cells [38, 41, 43, 44]. [score:3]
[1 to 20 of 5 sentences]
42
[+] score: 23
Similarly, miR-26a also targets and suppresses Ezh2 in differentiating myocytes, although it is not clear if MyoD regulates its expression [48, 49]. [score:8]
Interestingly, upregulation of several miRNAs (miR-214, miR-26, and miR-29) collaboratively represses PcG complex expression and function in myocytes and thereby promotes muscle-specific gene expression and differentiation (Figure 1). [score:8]
For example, miR-24 can promote myogenic differentiation by targeting and inhibiting Smad 3 [59], while miR-26a represses Smad 1 and Smad 4 expressions [49]. [score:7]
[1 to 20 of 3 sentences]
43
[+] score: 23
DNMT3B mRNA contains a miR-26a target site in its 3′untranslated region (3′UTR), and miR-26a reduces the translation of DNMT3B by binding to its mRNA. [score:7]
Down-regulated of miR-26a in TSCC increases the level of DNMT3B, promoting DNA methylation and inhibiting transcription [51, 54]. [score:6]
/ down TSCCInhibits cell proliferation and the cell cycle, promotes cell apoptosis; DNMT3B is the intermediary by which miR-26a regulates expression in TSCC [51]. [score:6]
The reduction of the miR-26a levels in TSCC down-regulates by increasing the DNA methylation levels. [score:4]
[1 to 20 of 4 sentences]
44
[+] score: 23
Expression of miR-26 in liver cancer cells in vitro induces cell cycle arrest via suppression of cyclin D2 and cyclin E2, and systemic administration of miR-26 in mouse HCC mo del induces inhibition of cancer cell proliferation and induction of tumor-specific apoptosis without toxicity [61]. [score:7]
Activation of this pathway also accounts for the gender differences and risk of HCC, as estrogen is known to suppress MyD88 -dependent IL-6 production, and miR-26 is expressed at a higher level in women than men in the liver [58, 59]. [score:5]
Patients whose tumors had low miR-26 expression had shorter survival but a better response to interferon therapy than did patients whose tumors had high expression of this miRNA [58]. [score:5]
However, as individual miRNAs regulate hundreds of transcripts, antiproliferative effects of miR-26 in HCC, might not attribute to a single oncogeneic pathway but a regulation of multiple pathways, such as c-Myc and p53 -dependent pathway. [score:3]
On the other hand, Ji, et al. showed that tumors with reduced miR-26 expression had a distinct transcriptomic pattern, with the activation of NF-κB and IL-6 signaling pathways [58]. [score:3]
[1 to 20 of 5 sentences]
45
[+] score: 23
Among these: 3 miRNAs (i. e. miR-26a-5p, miR-143-3p, and miR-4454) were expressed in both RAA and LAA; 6 miRNAs (i. e. miR-30c-5p, miR-125b-5p, miR-133b, miR- 145-5p, miR-451a, and miR-4484) were expressed in only RAA; and 3 miRNAs (i. e. miR-1, miR-23b-3p, and miR-494) were expressed in only LAA. [score:7]
Luo et al. [13] identified miR-26 as a potentially important regulator of KCNJ2 gene expression and, via I [K1], a determinant of AF susceptibility. [score:4]
28E-02hsa-miR-331-3p1402470.826.46E-02hsa-miR-149-3p961630.776.79E-02hsa-miR-181a-5p105716130.618.50E-02hsa-miR-30a-5p2493760.596.94E-02hsa-miR-197374511230.596.02E-02hsa-miR-4497457465460.524.68E-02Down-regulated (n = 20*)hsa-miR-1127403079−2.051.94E-02hsa-miR-26b-5p794198−2.002.30E-02hsa-miR-44541262488−1.373.93E-02hsa-miR-361-5p652259−1.333.53E-02hsa-miR-151a-5p694302−1.203.90E-02hsa-miR-26a-5p97024314−1.177.22E-03hsa-miR-378a-3p683307−1.157.26E-02hsa-miR-5190311141−1.149.06E-02hsa-miR-5100775363−1.102.89E-02hsa-miR-151b609288−1.086. [score:4]
To determine the probable biological function of the AF -associated miRNAs, we predicted the putative targets and pathways of 10 validated miRNAs (i. e. miR-1, miR-23b-3p, miR-26a-5p, miR-30c-5p, miR-125b-5p, miR-133b, miR-143-3p, miR-145-5p, miR-4454, and miR-4484) using the miRFocus database. [score:3]
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (i. e. miR-1, miR-26, and miR-328) or structural remo deling (i. e. miR-30, miR-133, and mir-590). [score:3]
42E-02hsa-miR-145-5p72843352−1.128.73E-02hsa-miR-378a-3p477221−1.118.70E-02hsa-miR-30b-5p1857869−1.105.33E-02hsa-miR-26b-5p1342638−1.075.00E-02hsa-miR-133b39121868−1.079.81E-02hsa-miR-107592284−1.063.95E-02hsa-miR-152293141−1.057.94E-02hsa-miR-30a-5p409201−1.032.72E-02hsa-miR-125b-5p76023820−0.997.43E-02hsa-miR-4286243128−0.928.45E-02hsa-miR-191-5p1441767−0.917.19E-02hsa-miR-26a-5p96215219−0.886.04E-02hsa-miR-21-5p633351−0.858.92E-03hsa-miR-30d-5p1225692−0.825.79E-02hsa-miR-5100458274−0.748.76E-02hsa-miR-181a-5p998613−0.703. [score:1]
According to the qRT-PCR data, miR-26a-5p, miR-143-3p, miR-4454 were AF -associated miRNAs found in both RAA and LAA tissues, while miR-30c-5p, miR-125b-5p, miR-133b, miR-145-5p, miR-4484 were AF -associated miRNAs found in only RAA tissues and miR-1, miR-23b-3p were found only in LAA tissues (Figure  5). [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 22
MYC induced by H. pylori CagA in gastric cancer cells can suppress the expression of let-7a and let-7c through two epigenetic approaches: (1) MYC stimulates EZH2 expression by reducing its negative regulators, miR-26a and miR-101; (2) MYC interacts with DNMT3B and EZH2 on the let-7 promoter, and consequently the let-7 gene is silenced through both DNA and histone methylation. [score:8]
Likewise, miR-26a and miR-137 are silenced by promoter CpG island hypermethylation, which induces the up-regulation of the target gene LSD1 in colorectal adenomas and EZH2 in prostate cancer. [score:6]
The miR-26a can be silenced by DNMTs in prostate cancer, which induces the accumulation of its target gene EZH2 and changes the global DNA methylation status [41], supporting the idea that miRNAs can mediate the interplay between epigenetic regulators. [score:4]
A positive feedback loop exists between MYC and EZH2: MYC stimulates EZH2 expression by reducing its negative regulators, miR-26a and miR-101; EZH2 can also increase the abundance of MYC by repressing miR-494. [score:4]
[1 to 20 of 4 sentences]
47
[+] score: 22
However, the therapeutic approach of miR-26a needs to be carefully considered based on the fact that miR-26a has been found to be up-regulated in T-ALL patients and its expression enhanced leukemogenesis in a mouse mo del of T-ALL by suppressing the levels of PTEN and BIM tumor suppressor protein (77). [score:9]
Men dell's lab demonstrated that systemic delivery of a miR-26a -expressing adenoviral particle via tail intravenous injections into a MYC -induced hepatocellular carcinoma mouse mo del resulted in inhibition of cancer cell proliferation, induction of tumor-specific apoptosis, and dramatic protection from disease progression, without toxicity (77). [score:7]
MiR-26a is strongly down-regulated in hepatocellular carcinoma (HCC) as compared with paired non-cancerous tissues, and miR-26a's low expression is associated with a shorter overall survival but a better response to interferon therapy (76). [score:5]
Examples include miR-26 (31,32), miR-143/145 cluster (33), miR-181 family (34), miR-200 family (35), miR-203 (10,36), miR-31 (37), and miR-192/194/215 (38). [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 22
Surprisingly, the use of antagomirs for miR-125b-5p and miR-26a-5p resulted in slight but significant downregulation of LMOD1, ADAMTS19 and NAV1 (Fig.   2b–d), a result opposite than the predicted regulation, which possibly indicates an indirect mechanism of effect of these two miRNAs on these targets. [score:8]
MiR-26a has previously been reported to be over expressed in lung epithelia during development and to be involved in glomerular and tubular injury related to podocyte damage and maintenance of glomerular filtration rate [38]. [score:3]
Expression of let-7a (a), miR-125b-5p (b), miR-16-5p (c), miR-26a-5p (d) and miR-29b-3p (e) was assessed by RT-PCR in HK2 cells treated or not with antagomirs. [score:3]
Expression of E3 ubiquitin-protein ligase DXT4 (DTX4) (a), leiomodin-1 (LMOD1) (b), a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19 (ADAMTS19) (c) and neuron navigator 1 (NAV1) (d) was assessed by RT-PCR in HK2 cells treated or not with antagomirs against let-7a, miR-125b-5p, miR-16-5p, miR-26a-5p or miR-29b-3p. [score:3]
In the presence of antagomirs, the detected signal of let-7a, miR-16-5p, miR-125b-5p, miR-26a-5p and miR-29b-3p was significantly decreased (Fig.   1). [score:1]
In addition, a slight but significant inverse correlation with pelvic diameter was also observed for miR-let-7a-5p and miR-125-5p and with hydronephrosis grade for miR-let-7a-5p and miR-26a-5p, and a slight but significant positive correlation with age for miR-let-7a-5p and miR-16-5p (Table  4). [score:1]
MiRNAs let-7a-5p, miR-125b-5p, miR-16-5p, miR-26a-5p and miR-29b-3p were consistently modified in mice and humans. [score:1]
These five miRNAs were let-7a-5p miR-16-5p, miR-29b-3p, miR-125b-5p and miR-26a-5p (Table  3). [score:1]
67488992), hsa-miR-26a-5p (ref. [score:1]
[1 to 20 of 9 sentences]
49
[+] score: 22
We performed Monte Carlo analysis on the 2102Ep and NTera-2 differential gene expression datasets and cross-referencing with the results with the differential miRNA expression results revealed 10 miRNAs in 2102Ep cells (mir-26a, miR-28, miR-30c, miR-148a, miR-200b, miR-517b, miR-518a-3p, miR-518b, miR-518c, miR-518f) and two miRNAs in NTera-2 cells (miR-200c and miR-367) to be potential master regulators of their inversely regulated target genes. [score:9]
The significant representation of known and putative miRNA inhibitors of EMT with validated EMT targets (miR-200b, miR-200c, miR-30c, miR-148a and miR-26a) provides functional significance to the wider SOX2-regulated miRNA-target network revealed in this study. [score:8]
Additionally, miR-26a has targets that were verified in non-EMT studies, but which have independently established functions in EMT and metastasis. [score:3]
These include HMGA2 and LEF1 (miR-26a) [60, 62, 75]. [score:1]
While miR-26a, miR-30c, miR-148a, miR-200b, miR-200c and miR-367 are broadly conserved across vertebrate species, miR-28 is conserved only in mammals and miR-517b, miR-518f, miR-518b, miR-518c, miR-518a-3p, all as members of the C19MC polycistron, are found only in primates. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 21
In order to validate the miRNAs that were significantly deregulated in the array (miR-26a-1-3p and miR-576-3p) and to verify the expression of the miRNAs only detected in infected cells in the expression profile array (miR-217, miR-26a-2-3p and miR-92a-1-5p), we designed specific primers for each miRNA and checked its expression by RT-qPCR (Fig 3). [score:7]
As most of those miRNAs are previously annotated as star miRNAs (as example of miR-26a-1-3p previously annotated as miR-26a-1*) and some prediction database algorithms use proved interaction as criteria for prediction, we only selected miR-217 and miR-576-3p, both mature strand miRNAs, for further target prediction analysis (one detected only in infected cells and the other one up-regulated significantly upon infection in the array, respectively, and both validated). [score:6]
MiRNAs miR-324-3p (1.73x), miR-1227 (1.95x), miR-362-3p (1.85x), miR-99b-3p (2.21x), miR-19b-1-5p (4.11x), miR-628-3p (2.77x), miR-26a-1-3p (42.47x), miR-576-3p (2.49x) and miR-27a-5p (108x) were up-regulated, in OROV-infected cells relative to uninfected cells. [score:4]
To confirm the robustness of our analysis, we further validated the expression of three other less stable star miRNAs: the highly significant miRNA miR-26a-1-3p and two miRNAs detected only upon infection, miR-26a-2-3p and miR-92a-1-5p (Fig 3C). [score:3]
From the thirteen selected miRNAs from the screening, only miR-576-3p and miR-26a-1-3p sustained significance (p ≤ 0.05, p ≤ 0.01, respectively) after Bonferroni correction according to the method used in this study. [score:1]
[1 to 20 of 5 sentences]
51
[+] score: 21
Several studies on breast cancer have shown that miR-26a can inhibit cell proliferation, colony formation and migration, as well as promote apoptosis by regulating several carcinogenesis-related processes, including several mechanisms that involve the targeting of MCL-1, MTDH and EZH2 [42, 43]. [score:6]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Has-miR-26a and has-miR-27b were both found in ovarian tumor cells and their corresponding exosomes; however, their expression levels significantly differ between the two samples [34]. [score:3]
In addition to the let-7 family, other miRNAs, such as miR-21-5p and miR-26a-5p, were also highly expressed in the intracellular and extracellular esophageal cancer samples. [score:3]
In the present study, has-miR-21, has-let-7 family, miR-26a and miR-27b were abundant in EC9706 cells and their corresponding exosomes. [score:1]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
[1 to 20 of 8 sentences]
52
[+] score: 21
Interestingly, MYC contributes to EZH2 upregulation through repression of miR-26a, which targets EZH2, while EZH2 upregulates MYC by inhibiting miR-494, which targets MYC. [score:13]
Enhancer of Zeste homolog 2 (EZH2) is overexpressed in recurrent nasopharyngeal carcinoma and is regulated by miR-26a, miR-101, and miR-98. [score:4]
MicroRNA-26a targets the histone methyltransferase Enhancer of Zeste homolog 2 during myogenesis. [score:2]
In addition, several other miRNAs, including miR-26a (Wong and Tellam, 2008), miR-98 (Alajez et al., 2010), miR-124 (Zheng et al., 2012), miR-144 (Guo et al., 2013), miR-214 (Derfoul et al., 2011), and let-7 (Kong et al., 2012) are also reported to negatively regulate EZH2 (Figure 2). [score:2]
[1 to 20 of 4 sentences]
53
[+] score: 21
Similar discrepancies were also observed for miR-26a and miR-29a, which were down-regulated in our study and up-regulated in the study of Lee and co-workers [18] (Figure 3). [score:7]
Interestingly, miR-26a-1 is located in sites of frequent chromosomal instability [14] and it is down-regulated in many other tumour types, namely in thyroid anaplastic [30] and breast carcinomas [31]. [score:4]
At least eight miRNAs showed significant down-regulation between normal cervical samples and the pre-neoplasic and neoplasic samples, namely miR-143, miR-145, miR-99a, miR-26a, miR-203, miR-513, miR-29a and miR-199a. [score:4]
Eight miRNAs exhibited relative decreased expression with transition from normal cervix to atypical dysplasia to cancer (miR-26a, miR-143, miR-145, miR-99a, miR-203, miR-513, miR-29a, miR-199a) (Figure 4A). [score:3]
The microarray data of miR-26a showed that its expression was decreased in pre-neoplasic and cancer in comparison with normal cervical samples. [score:3]
[1 to 20 of 5 sentences]
54
[+] score: 20
In glioma, miR-26a has been found overexpressed in a subset of high-grade gliomas and directly targets the PTEN transcript [29]. [score:6]
Thus, the miR-26 family, in part, has similar function, and is consistently down-regulated in a wide range of malignant tumors, including HCC. [score:4]
miR-26 regulates numerous target genes simultaneously and its role is completely different in certain tumors. [score:4]
The low expression of miR-26 is closely related with short overall survival of HCC patients [33– 37]. [score:3]
In HCC, miR-26a has been found to induce a G1 arrest and increase tumor-specific apoptosis [31]. [score:1]
The miR-26 family is composed of miR-26a-1, miR-26a-2 and miR-26b located on chromosomes 3, 12 and 2, respectively. [score:1]
The mature miRNA of miR-26a-1 and miR-26a-2 possesses the same sequence, with the exception of two different nucleotides in mature miR-26b. [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 20
Initially, we examined the expression of miR-101, miR-124, miR-26a, let-7 by qPCR between PCSCs and non-PCSCs, and found that miR-101 expression was significantly down-regulated in PCSCs (Figure 4A). [score:8]
Down-regulation of miR-101, miR-124, miR-26a, let-7 have been reported in leading to EZH2 over -expression in various kinds of cancer [17– 26]. [score:6]
We examined the expression of miR-101, miR-124, miR-26a, let-7 between PCSCs and non-PCSCs, and found that miR-101 expression was inversely correlated with EZH2’s mRNA level. [score:5]
As previously confirmed, miR-101, miR-124, miR-26a, let-7 can interact with EZH2 in many types of cancer, including glioblastoma, prostate, gastric, breast and bladder cancer [17– 26]. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 20
This miRNA targets the “Never In Mitosis Gene A-related kinase 6” gene, which was strongly upregulated in the same samples (suggesting loss of inhibition due to miR-26a) and has been linked to cell proliferation. [score:8]
A similar role was reported for miR-26a in MDV infection, where it inhibited lymphoma cell proliferation by targeting NEK6, thus playing a role as a tumor suppressor (133). [score:7]
Similarly, miR-26a was found to be downregulated in MDV-infected chicken spleens during different phases of tumor formation (139). [score:4]
For instance, miR-26a acts by enhancing type I IFN-signaling pathways and augmenting the production of IFN-stimulated genes, thus blocking virus replication (169). [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 20
The most significant downregulation was observed for tumor suppressive miRNAs of the, miR-26, -30 and -200 families. [score:6]
Vice versa, the adenoviral delivery of the tumor-suppressive miR-26 was shown to suppress mouse liver tumorigenesis [33]. [score:5]
The three tumor-suppressive miRNA-families miR-26 [31], -30 [38] and [27] were suggested to be expressed at lower levels in PTCs. [score:5]
However, by comparing ATC samples with NTs, FTCs and PTCs, we observed a significant reduction in miR-26a/-b andg expression in FTCs. [score:3]
Our recent analyses confirmed these observations for the miR-26 and families [30]. [score:1]
[1 to 20 of 5 sentences]
58
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The expression analysis of selected miRNAs using qRT-PCR also showed that miR-26a and -99a were highly expressed in all tissues, while miR-122 and miR-133a were predominantly expressed in liver and muscle, respectively. [score:7]
The expression profiles of the 11 miRNAs across 11 tissues confirmed that miR-26a and -99a expressed at high levels in all tissues, while miR-122 and -133a exclusively expressed in liver and muscle, respectively. [score:7]
The higher expression level of three conserved miRNAs (miR-26a, -99a and -150) in all tested bovine tissues suggest that these miRNA may be more relevant to the highly conserved biological process in mammalians. [score:3]
To validate above miRNA expression patterns, quantitative RT-PCR was performed on tissue-specific miRNAs (miR-122, -133a), high cloning frequency miRNAs (miR-26a, -99a and -150) and low cloning frequency miRNAs (miR-103, -107, -411, -423-5p, -574-3p and -652). [score:3]
[1 to 20 of 4 sentences]
59
[+] score: 19
Interestingly, in U87 cell lines lacking the expression of PTEN, miR-26a-5p was still capable of inhibiting tumor growth, and the overexpression of PTEN or RB1 could both antagonize the proliferative effects of miR-26a-5p [69]. [score:7]
Three upregulated miRNAs, miR-23a-3p, miR-26a-5p and miR-17-5p, directly target PTEN in GBM [47, 49– 51]. [score:7]
miR-26a-5p, which has been discussed previously as targeting PTEN, also targets RB1 in GBM. [score:5]
[1 to 20 of 3 sentences]
60
[+] score: 19
For instance, miR-26a has been shown to target the transcription factor SMAD1 during the differentiation of stem cells [41] and we have previous shown that this is selectively expressed in the bronchial and alveolar epithelial cells in mouse lung [28]. [score:5]
Expression profiling of human airway biopsies revealed several highly expressed miRNAs, including miR-92, miR-200c, miR-26a, miR-16, let-7b, miR-125a and miR-125b, which together comprised 55.5% of the total miRNA species analysed. [score:5]
This suggests that miR-26a might be important in controlling essential developmental and physiological events in the lung, which may also include pathological events during pulmonary diseases such as asthma. [score:4]
This analysis revealed that miR-92, miR-26a, miR-200c, miR-16, let-7b, miR-125a, and miR-125b were the most highly expressed in human airway tissue, having levels more than 70-fold higher than the average miRNA and contributing 55.5% of the total mRNA detected in airway biopsies. [score:3]
In addition, members of the let-7 family (let-7a, let-7b and let-7c), miR-26 family (miR-26a and miR-26b), miR-125 family (miR-125a and miR-125b) and miR-30 family (miR-30a-5p, miR-30b and miR-30c) also fell within the highly expressed category and are therefore considered to be human airway specific (figure 4). [score:2]
[1 to 20 of 5 sentences]
61
[+] score: 19
Subsequently, we compared the expression levels of 410 co-expressed miRNAs between XY and YY testis (Table S5), and found a similar expression level for 93% co-expressed miRNAs, such as 5 dominantly expressed miRNAs, miR-26a, miR-7g, miR-200a, miR-200b and miR-103. [score:10]
The nine miRNAs includes four miRs (miR-16-5p, miR-21-3p, miR-462-5p, miR-731-3p) relatively high expressed in XX and five miRs (let-7g-5p, miR-26a-5p, miR-135c-5p, miR-193b-3p, miR-200b-3p) relatively high expressed in XY. [score:5]
These sex-enriched miRNAs (except miR-26a in YY testis) had at least 2-fold difference in expression between male and female gonads. [score:3]
In addition, we found three most abundant miRNAs (miR-146a, -21, -462) in XX ovary, and four most abundant miRNAs (miR-26a, -7g, -200a, -200b) in XY testis and YY testis. [score:1]
[1 to 20 of 4 sentences]
62
[+] score: 18
It was demonstrated that miR-26a -loaded QD nanocomplexes can up-regulate miR-26a expression, arrest cell cycle resulting in the inhibition of cancer cell proliferation in HepG2 cells [168]. [score:8]
Tanno T Zhang P Lazarski CA Liu Y Zheng P An aptamer -based targeted delivery of miR-26a protects mice against chemotherapy toxicity while suppressing tumor growthBlood Adv. [score:5]
DNA aptamer based anti-human KIT sequences and mouse c-KIT aptamer targeted delivery of miR-26a protects mice from chemotherapy toxicity while suppressing tumour growth [156]. [score:5]
[1 to 20 of 3 sentences]
63
[+] score: 17
Indeed, our reporter assays showed that miR-34a (Fig. S5 B and F), miR- 206 (Fig. S5 C and G), and miR-26a (Fig. S5 D and H) mimics suppressed the reporter activity of the constructs containing each target on the p72 3′UTR, whereas miR-206 mimic also decreased that of the construct containing a target on the p68 3′UTR (Fig. S5 A and E). [score:6]
Further analysis by TargetScan also revealed the existence of possible target sites of miR-206 and miR-34a/miR-206/miR-26a in the 3′UTRof p68 and p72, respectively, in a wide range of animal species. [score:5]
A-D) Schematic depiction of pGL3-Promoter plasmids fused to two tandem repeats of 3′UTR fragments containing a potential target site for miR-206 of p68 (A), miR-34a of p72 (B), miR-206 of p72 (C), or miR-26a of p72 (D) and corresponding mutants. [score:3]
This was intriguing, since miR-206 and miR-26a are a set of miRNAs whose processing was proven to depend on the p53/p68/p72 complex [14]. [score:1]
miRNA mimics of miR-143, miR-145, miR-34a and miR-26a were purchased from Qiagen GmbH (Hilden, Germany), and miR-206 mimic was obtained from Ambion. [score:1]
For luciferase reporter assay, the 3′UTR fragments of the mouse p68 and p72 containing possible target sites for miR-145, miR-26a, miR-34a or miR-206 were amplified from genomic DNA of a C57BL/6 mouse by PCR using specific primers containing an XhoI site at the 5′end. [score:1]
[1 to 20 of 6 sentences]
64
[+] score: 17
Strong inverse correlation was observed between the tumor suppressor PTEN and several members of the miR-17, miR-19, miR-130/301 and miR-26 families, which were upregulated in the osteosarcoma cell lines. [score:6]
PTEN was downregulated in both osteosarcoma cell lines and clinical samples, and is a verified target of miR-26a and members of the miR-106b-25 and miR-17-92 clusters [54], [55], [56], [57]. [score:6]
In addition, the expression of the tumor suppressor gene phosphatase and tensin homolog (PTEN) inversely correlated with miR-17, miR-20b, miR-9* and miR-92a (Table 2), but also showed a modest inverse correlation (r = −0.4 to −0.5) with other miRNAs of the miR-17, miR-19, miR-130/301 and miR-26 families (Table S6). [score:5]
[1 to 20 of 3 sentences]
65
[+] score: 17
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
In contrast, only 5 miRNAs (miR-21, miR-26a, miR-24, miR-30b and miR-29a) were found to be downregulated both in vitro and in vivo by EF24 treatment. [score:4]
Among the EF24-downpregulated miRNAs, which non-surprisingly included miR-21, miR-26a can transform cells and promotes glioma proliferation in vitro and in vivo [34]. [score:2]
[1 to 20 of 3 sentences]
66
[+] score: 17
Interestingly, systemic intravenous administration of a miRNA-26a inhibitor increased SMAD1 expression and rapidly induced angiogenesis associated with improved heart function [93]. [score:5]
A recent study suggests that miRNA-26a regulates pathological and physiological angiogenesis by targeting endothelial cell (EC) bone morphogenic protein/SMAD1 signaling in vitro and in vivo [93]. [score:4]
Icli B. Wara A. K. Moslehi J. Sun X. Plovie E. Cahill M. Marchini J. F. Schissler A. Padera R. F. Shi J. MicroRNA-26a regulates pathological and physiological angiogenesis by targeting BMP/SMAD1 signaling Circ. [score:3]
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
Zhang Z. H. Li J. Liu B. R. Luo C. F. Dong Q. Zhao L. N. Zhong Y. Chen W. Y. Chen M. S. Liu S. M. MicroRNA-26 was decreased in rat cardiac hypertrophy mo del and may be a promising therapeutic target J. Cardiovasc. [score:2]
[1 to 20 of 5 sentences]
67
[+] score: 16
The E2-regulated miR-30c has been reported to be a tumor suppressor in endometrial cancer [34], miR-107 functions as a tumor-suppressor gene in head and neck squamous cell carcinoma and was shown to mediate p53 tumor-suppressor function in human colon cancer cells [35, 36], and miR-26a strongly inhibited estrogen-stimulated breast cancer cells and tumor growth [6, 37]. [score:10]
Tan S. Ding K. Li R. Zhang W. Li G. Kong X. Qian P. Lobie P. E. Zhu T. Identification of miR-26 as a key mediator of estrogen stimulated cell proliferation by targeting CHD1, GREB1 and KPNA2Breast Cancer Res. [score:3]
Noticeably, several of the estrogen-repressed miRNAs (miR-26, miR-107, miR-126 and miR-145) were also reduced by the physiological estrogen levels of vitellogenic females [8]. [score:1]
As shown in Figure 1A, an overlap was observed between the lists of E2-repressed miRNAs of the different experimental mo dels, where miR-26a was included in all three of them (Table S1). [score:1]
Furthermore, eight of the E2-repressed miRNAs also contained the AGGGU motif in their terminal loop (let-7 family members, miR-26a and miR-125a), whereas this motif does not exist in any of the control miRNA terminal loop sequences (Table S2). [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 16
For example, miR-129-5p induces interferon-β which down-regulates E6 and E7 expression [19], miR-26a and miR-342-3p inhibit cell proliferation and invasion through each protein tyrosine phosphatase type IVA 1 and the mitogen-activated protein kinase (MAPK) pathway or forkhead box M1 [20, 21], and miR-101 regulates the cell cycle by inhibiting the G1-to-S transition [22]. [score:11]
Dong J. Sui L. Wang Q. Chen M. Sun H. MicroRNA-26a inhibits cell proliferation and invasion of cervical cancer cells by targeting protein tyrosine phosphatase type IVA 1 Mol. [score:4]
Fkih Mhamed I. Privat M. Ponelle F. Penault-Llorca F. Kenani A. Bignon Y. J. Identification of miR-10b, miR-26a, miR-146a and miR-153 as potential triple -negative breast cancer biomarkers Cell. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
In HCC has been reported up -expression of miR-21, miR-221, miR-22, miR-15, miR-517a, and down -expression of miR-122, miR-29 family, miR-26a, miR-124, let-7 family members, and miR-199a/b-3p (Szabo et al., 2012). [score:5]
Zhang and Pan (2009) have evaluated the effects of Hexahydro-1, 3, 5-trinitro-1, 3, 5-triazine (also known as hexogen or cyclonite) (RDX) on miRNA expression in mouse brain and liver, most of the miRNAs that showed altered expression, including let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181, were related to toxicant-metabolizing enzymes, and genes related to carcinogenesis, and neurotoxicity, in addition, consistent with the known neurotoxic effects of RDX, the authors documented significant changes in miRNA expression in the brains of RDX -treated animals, such as miR-206, miR-30a, miR-30c, miR-30d, and miR-195. [score:5]
[1 to 20 of 3 sentences]
70
[+] score: 16
In breast cancer, high expression of the hsa-miR-26a miRNA downregulates EZH2 and is therefore related to a favorable outcome on tamoxifen in metastatic breast cancer [41], and also interacts with CDK4 and CENTG1 oncogenes and forms an integrated oncomir/oncogene DNA cluster, which promotes glioblastoma tumor growth via RB1, PI3K/AKT, and JNK pathways [39]. [score:6]
Notably, however, five of these six miRNAs (hsa-miR-141, hsa-miRNA-26a, hsa-miR-29c, hsa-miR-148b, hsa-miR-193a-3p) showed significantly higher expression in both ER -positive cell lines and primary tumors, and one miRNA (hsa-miR-532-3p) showed significantly lower expression in both ER -positive cell lines and ER -positive tumors (see Table S4B in Additional file 1). [score:5]
Among these potentially novel ER-related miRNAs, four miRNAs (hsa-miR-26a, hsa-miR-92b, hsa-miR-191, hsa-miR-492) appear to show consistently higher expression across all the ER -positive cell lines (fold change ≥ 1.5), and as yet only hsa-miR-26a has been implicated in breast carcinogenesis whereas hsa-miR-26a and hsa-miR-92b have also been implicated in brain tumors [39, 40]. [score:3]
Another group of 17 miRNAs (hsa-miR-575, hsa-miR-155, hsa-miR-26b, hsa-miR-200a, hsa-miR-200b, hsa-miR-141, hsa-miR-200c, hsa-miR-190b, hsa-miR-492, hsa-miR-640, hsa-miR-196a, hsa-miR-29c, hsa-miR-93, hsa-miR-193a-3p, hsa-miR-191, hsa-miR-26a, hsa-miR-182) showed significantly higher expression in the major cluster compared with the other miRNAs (fold change ≥ 1.5) (Figure 2, bottom red box). [score:2]
[1 to 20 of 4 sentences]
71
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
A study identifying miRNAs expressed in myometrial and leiomyoma smooth muscle cells (MSMC and LSMC) using microarray and real time PCR reported that E [2] inhibited the expression of miR-21 in MSMC and LSMC, whereas E [2] increased and inhibited miR-26a in MSMC and LSMC, respectively [210]. [score:9]
In contrast, ICI 182,780 increased the expression of miR-20a and miR-21 in MSMC and LSMC, and miR-26a in MSMC, while inhibiting the expression of miR-26a in LSMC [210]. [score:7]
[1 to 20 of 2 sentences]
72
[+] score: 15
miR-26a enhances miRNA biogenesis by targeting Lin28B and Zcchc11 to suppress tumor growth and metastasis. [score:5]
MicroRNA-26a regulates glucose metabolism by direct targeting PDHX in colorectal cancer cells. [score:4]
Downstream of Wnt, MYC transcriptionally activates the miR-17-92 locus, but represses expression of miR-15, miR-26 and miR-30. [score:3]
Tumor suppression by miR-26 overrides potential oncogenic activity in intestinal tumorigenesis. [score:3]
[1 to 20 of 4 sentences]
73
[+] score: 15
MiR-26a has been reported as tumor suppressor miRNA and inhibited proliferation and migration through repression of MCL-1 (an anti-apoptotic member of the Bcl-2 family) in breast cancer [37]. [score:5]
Analogously, we also found that miR-26a was related to two of the four small molecule drugs and tended to be up-regulated in good prognosis groups (Table 2). [score:4]
In breast cancer, miR-200c and miR-26a have been proved to be aberrantly expressed [34– 37]. [score:3]
The fold change of miR-200c and miR-26a expression between good and poor prognosis groups (TCGA and GEO). [score:3]
[1 to 20 of 4 sentences]
74
[+] score: 14
Our results revealed up-regulation of miR-20a-5p and miR-451a, and down-regulation of miR-204-5p, miR-424-5p, miR-126-3p, miR-26a-5p and miR-9-5p in the sera of CHD-PAH patients. [score:7]
We found that two miRNAs (miR-20a-5p and miR-451a) were significantly up-regulated and five miRNAs (miR-204-5p, miR-424-5p, miR-126-3p, miR-26a-5p and miR-9-5p) were significantly down-regulated in CHD-PAH sera compared to the healthy controls (Fig. 7). [score:6]
We first performed first screen by pooling serum samples of 24 healthy subjects and 24 patients with CHD-PAH and fourteen miRNAs (miR-451a, miR-9, miR-424, miR-223, miR-204, miR-150, miR-328, miR-21, miR-34a, miR-34b, miR-26a, miR-27b, miR-126 and miR-20a) changed more than 1.5-fold. [score:1]
[1 to 20 of 3 sentences]
75
[+] score: 14
Notably the microRNAs upregulated in the control fascia accounting for the greatest differential in read count are heavily enriched in previously validated anti-fibrotic extracellular matrix targeting microRNAs (Table  1), including let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [27, 28], miR-27a-3p, miR-27b-3p [29, 30], miR-10a-5p [31], miR-26a-5p [32– 35], miR-101-3p [36– 39], and miR-10b-5p [40], as well as anti-proliferative microRNAs including, miR-126-3p [41– 47], miR-99a-5p [48– 54], miR-125a-5p [55– 59], and miR-139-5p [60– 62]. [score:6]
Our studies confirmed enrichment of microRNAs miR-10b, miR-7f, miR-101, miR-26a, miR-26b, miR-29a, and miR-30 in non-diseased palmar fascia samples. [score:3]
Wei C Kim IK Kumar S Jayasinghe S Hong N Castoldi G Catalucci D Jones WK Gupta S NF-κB mediated miR-26a regulation in cardiac fibrosisJ Cell Physiol. [score:2]
Liang H Gu Y Li T Zhang Y Huangfu L Hu M Zhao D Chen Y Liu S Dong Y Li X Lu Y Yang B Shan H Integrated analyses identify the involvement of microRNA-26a in epithelial-mesenchymal transition during idiopathic pulmonary fibrosisCell Death Dis. [score:1]
Liang H Xu C Pan Z Zhang Y Xu Z Chen Y Li T Li X Liu Y Huangfu L Lu Y Zhang Z Yang B Gitau S Lu Y Shan H Du Z The antifibrotic effects and mechanisms of microRNA-26a action in idiopathic pulmonary fibrosisMol Ther. [score:1]
Established anti-fibrotic microRNAs identified in our analysis include let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [28, 29], miR-27b-3p [30, 31], miR-10a-5p [33], miR-26a-5p [37– 40], miR-101-3p [41– 44], miR-27a-3p and miR-10b-5p [45]. [score:1]
[1 to 20 of 6 sentences]
76
[+] score: 14
Xie Q. Wei M. Kang X. Liu D. Quan Y. Pan X. Liu X. Liao D. Liu J. Zhang B. Reciprocal inhibition between miR-26a and NF-kappaB regulates obesity-related chronic inflammation in chondrocytes Biosci. [score:4]
Sun J. Feng M. Wu F. Ma X. Lu J. Kang M. Liu Z. Plasma miR-26a as a diagnostic biomarker regulates cytokine expression in systemic juvenile idiopathic arthritis J. Rheumatol. [score:4]
In obesity-related chondrocytes, miR-26a counteracts the positive regulation of NF-kB by saturated non-esterified fatty acid (NEFA), while NF-κB functions as a suppressor of miR-26a [75]. [score:4]
Interestingly, a negative and positive correlation of the BMI of OA patients with miR-26a and nuclear factor kappa B (NF-kB), respectively, has been reported. [score:1]
In primary chondrocytes derived from mice fed with a high fat diet, levels of miR-26a were decreased in comparison to mice fed with a standard chow diet, whereas, in contrast, the levels of the transcripts of pro-inflammatory cytokines were increased. [score:1]
[1 to 20 of 5 sentences]
77
[+] score: 14
Due to its negative regulation on some of these tumor suppressor-like miRNAs, including miR-16 and miR-26a, ERα can amplify the tumorigenic signals from VEGF [71], EZH2 [72] and some oncogenes that are targeted by miR-16 or miR-26a in breast epithelial cells. [score:6]
Conversely, such an upregulation was reversed by estrogen (E2) treatment, suggesting that estrogen and its receptor signaling are negative regulators for certain miRNAs, including miR-16, miR-26a, miR-29a, miR-125a, miR-143, miR-145, miR-195, etc. [score:5]
Along with the non-transcriptional induction of miR-15a, miR-16, miR-26a, and miR-145, the observation that miR-34a was the only transcriptionally regulated miRNA in both studies is the key to linking these two studies together. [score:2]
These miRNAs include miR-15a, miR-16-1, miR-23a, miR-26a, miR-103, miR-143, miR-145, miR-203, as well as miR-34a that had previously been determined to be induced by p53 [52]. [score:1]
[1 to 20 of 4 sentences]
78
[+] score: 14
Other miRNAs from this paper: mmu-mir-26a-1, mmu-mir-26a-2, hsa-mir-26a-2, hsa-mir-374a
miR-26a suppresses WNT-5A and forced expression of miR-26a attenuates cell proliferation, metastasis, and EMT, and induced G1 phase arrest suppressing WNT-5A expression and inhibiting prostate cancer progression [176]. [score:11]
A study has found that microRNA-26a expression is reduced in prostate cancer cells [176]. [score:3]
[1 to 20 of 2 sentences]
79
[+] score: 13
Significant upregulation of hsa-miR-26a in BSE-infected macaques could not be confirmed using this independent method. [score:4]
Using this technique we could confirm the upregulation of hsa-miR-26a, -342-3p and -494 in the brain of six BSE-infected macaques compared to five non-infected controls (Figure 1A). [score:3]
C [T]-values derived from 4 independent qRT-PCR experiments comparing the expression of miRNAs hsa-miR-26a, hsa-miR-124a, hsa-miR-143, hsa-miR-145, hsa-miR-342-3p, and hsa-miR-494 in BSE-infected vs. [score:3]
The relative expression of selected miRNA candidates hsa-miR-26a, hsa-miR-124a, hsa-miR-143, hsa-miR-145, hsa-miR-342-3p, and hsa-miR-494 were validated by quantitative reverse transcription PCR (qRT-PCR) analysis using a higher number of animals. [score:3]
[1 to 20 of 4 sentences]
80
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Expression of miR-26a, miR-29c, miR-130b and miR-146a was higher in patients with an Imatinib response than in patients with Imatinib-resistant treatment [47]. [score:3]
In 40 non-M3 AML patients, high expression of miR-26a, miR-29b and miR-146a was associated with short overall survival [65]. [score:3]
Plasma miR-511, miR-222, and miR-34a were up-regulated in B-ALL patients compared with normal controls, whereas plasma miR-199a-3p, miR-223, miR-221, and miR-26a were lower in B-ALL patients [167]. [score:3]
Analyzing 53 AML patients, increased expression of miR-26a, miR-29b, miR-146a, and miR-196b was associated with an unfavorable overall survival [65]. [score:3]
Analyses of over 430 miRNAs in 50 clinical T-ALL samples revealed a common signature: miR-223, miR-19b, miR-20a, miR-92, miR-142-3p, miR-150, miR-93, miR-26a, miR-16 and miR-342 [59]. [score:1]
[1 to 20 of 5 sentences]
81
[+] score: 13
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-26a-2
The relative locations of RNA editing sites, miRNA target sites, as well as the predicted RNA secondary structures are illustrated in Fig.   7b, c. Both genes were confirmed as miRNA target genes (miR-24 targeting GOLGA3 and miR-26 targeting GINS1) (Supplementary Fig.   11,). [score:9]
To make miRNA sponge vectors, three copies of miR-24 and miR-26 target sequences were inserted into the 3′ UTR of a GFP reporter via EcoRI and BamH I cloning sites (Supplementary Table  2). [score:3]
A total of 2.5 μg miR-24 or miR-26 sponge vector were transfected into HEK293 cells. [score:1]
[1 to 20 of 3 sentences]
82
[+] score: 13
Other miRNAs from this paper: hsa-mir-145, hsa-mir-26a-2, hsa-mir-384
MiR-26a is highly expressed in chronic lymphocytic leukemia cell lines which are often resistant to TRAIL -induced apoptosis, while miR-145 is down-regulated in colorectal and prostate carcinomas, which are generally sensitive to TRAIL -induced apoptosis [40- 43]. [score:6]
miRNA-26a has also been implicated in regulation of Caspase-3 levels [21]. [score:2]
Interestingly it has recently been shown that miR-26a is repressed by MYC [44]. [score:1]
We have demonstrated a role for miR-26a, miR-145 and miR-26a in TRAIL -induced apoptosis. [score:1]
Three of these seed sequences appear in the human miRNAs miR-26a, miR-145 and miR-384. [score:1]
Finally we used the enriched seed sequences to identify miRNAs that may be involved in TRAIL -induced apoptosis, identifying miRNAs miR-26a, miR-145 and miR-384 as affecting TRAIL -induced cell death in a range of cell types. [score:1]
In two of the three cases (miR-26a and miR-145) this difference was still significant after correction for multiple testing. [score:1]
[1 to 20 of 7 sentences]
83
[+] score: 13
Potential target transcripts, which mature sequences for mir-24-2, mir-26a, and mir-351 might be repressing, were predicted and rather than considering targets individually, scores were combined multiplicatively to identify potential transcripts that might be synergistically repressed by all three (Table 4), a method that penalizes targets where one or more scores are abnormally low. [score:7]
Top 10 predicted targets for synergistic repression by mir-24, mir-26a, and mir-351. [score:3]
In contrast, Dystrophin's shorter 3′UTR is targeted only by mature mir-26a (Data not shown). [score:3]
[1 to 20 of 3 sentences]
84
[+] score: 13
Because EZH2 is a target of miR-25 (Esposito et al., 2012), miR-26a (Sander et al., 2008), miR-30d (Esposito et al., 2012), miR-101 (Varambally et al., 2008), and (Derfoul et al., 2011), downregulation of miR-25, miR-26a, miR-30d, miR-101, and in human cancers are associated with EZH2 upregulation and malignant phenotypes. [score:9]
MYC stimulates EZH2 expression by repression of its negative regulator miR-26a. [score:4]
[1 to 20 of 2 sentences]
85
[+] score: 12
Mature miRNA expression could be classified into two groups: i) cardia-tissues: miRNAs rarely expressed in other tissues but expressed in gastric cardia, including miR-148a, miR-192, miR-200a and miR-200b; ii) quasi-ubiquitous: miRNAs expressed in many tissues and conditions, including miR-29c, miR-21, miR-24, miR-29b, miR-29a, miR-451, miR-31, miR-145, miR-26a, miR-19b and let-7b. [score:9]
The high expression levels of miRNAs identified by ultra-deep sequencing (in descending order: miR-29c, miR-21, miR-148a, miR-29a, miR-24, miR-29b, miR-192, miR-451, miR-145, miR-31, miR-200a, miR-19b, miR-200b, let-7b and miR-26a) were validated with the TaqMan miRNA assays (Life Technologies). [score:2]
hsa-miR-26a ANKRD52 ; UBN2 ; TNRC6B ; EPS15 ; BRWD1 ; PTEN ; CDK6 ; PTPRD ; IGF1 ; KIAA2018 ; GMFB ; SH3PXD2A ; KLF4 ; C11orf41 ; PIK3R3 ; PDIK1L ; TP53INP1 ; CCND2 ; PTP4A1 ; MIB1. [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 12
The tissue levels of miR-26a is down-regulated in animal mo dels of AKI, and experimental overexpression attenuates renal IRI and improves renal recovery [32]. [score:6]
miR-26a represses IL-6 expression to promote the expansion of regulator T cells (Tregs). [score:4]
Decreased blood levels of miR-26a and miR-27a prior to cardiac surgery also predict AKI later on [18]. [score:1]
Decreased blood levels of miR-26a and miR-27a predict AKI in the ICU. [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 12
It has been shown that over -expression of miR-26a via AVV suppresses tumorigenesis with no signs of hepatoxicity or dysregulation of endogenous miRNAs (murine liver cancer mo del) [203]. [score:6]
miR-26a is a tumour suppressor miR that is known to be down-regulated in multiple cancers, including breast cancer. [score:6]
[1 to 20 of 2 sentences]
88
[+] score: 12
Additionally, a combination of four miRNAs (miR-19b, miR-23b, miR-26a, and miR-92a) was found to regulate PTEN expression post-transcriptionally and to affect the downstream PI3K/Akt pathway via PIK3CA (p110α), PIK3CD (p110δ), PIK3R1 (p85), Akt, and cyclin D1, thus promoting prostate cancer cells proliferation in vitro (98). [score:4]
MiR-26a negatively regulates the expression of PTEN in a murine glioma mo del and enhances the formation of tumors de novo (91). [score:3]
For instance, PTENp1 was found to sequester several miRNAs families that target PTEN mRNA, such as miR-17, miR-19, miR-21, miR-26, and miR-214, among others (110). [score:3]
MiR-26a also enhances lung cancer metastasis via modulation of metastasis-related genes and PTEN inhibition (92). [score:2]
[1 to 20 of 4 sentences]
89
[+] score: 12
These two miRs exhibit an opposite mechanism in regulating their respective targets: miR-26 mainly shows a direct correlation, which introduces to an indirect and difficult to unravel mechanism of regulation, whereas miR-34a displays a canonical down-regulation of its targets. [score:12]
[1 to 20 of 1 sentences]
90
[+] score: 12
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
These mRNAs are all included in the list of predicted target in Table 2. It was interesting to see that the four remaining miRNAs (miR-100, rno-miR-140, miR15a and miR-26a) were grouped in this network by IPA and not connected through the above cancer-related target mRNAs by the pathway designer and hence two of them (miR-100 and miR-15a) were not included in Figure 4A. [score:5]
[1 to 20 of 2 sentences]
91
[+] score: 12
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
AAV -mediated miR-26 delivery into a murine mo del of liver cancer shows promise for miR replacement therapy [82]. [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 12
For example, miR-26a that is upregulated in glioma tissues suppresses PTEN, RB1 and MAP3K2/MEKK2 expression and inhibits c-JUNN-terminal kinase -dependent apoptosis [62, 113]. [score:10]
Huse J. T. Brennan C. Hambardzumyan D. Wee B. Pena J. Rouhanifard S. H. Sohn-Lee C. le Sage C. Agami R. Tuschl T. The PTEN -regulating microRNA miR-26a is amplified in high-grade glioma and facilitates gliomagenesis in vivo Genes Dev. [score:2]
[1 to 20 of 2 sentences]
93
[+] score: 12
While miR-155, miR-17-5p, and miR-26a target Ras homolog enriched in brain (Rheb), Mcl-1/STAT3, KLF4, respectively, and play a positive role in autophagy regulation during Mtb infection. [score:4]
Sahu et al. (2017) reported that miR-26a mimic attenuates Mtb survival in macrophages by targeting the transcription factor KLF4. [score:3]
MicroRNA 26a (miR-26a)/KLF4 and CREB-C/EBPβ regulate innate immune signaling, the polarization of macrophages and the trafficking of Mycobacterium tuberculosis to lysosomes during infection. [score:2]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016 With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
Mycobacterium tuberculosis decreases human macrophage IFN-g responsiveness through miR-132 and miR-26a. [score:1]
[1 to 20 of 6 sentences]
94
[+] score: 12
Kinases and transcription factors important in immune-cell differentiation and regulation such as Blimp-1 51, p53/MDM2 52 and PTEN 53 may be targets of miR-30a, miR-30d, miR-192 and miR26a, all CIR-miRNAs downregulated in sepsis, in our study. [score:7]
Particularly, miR-26a was reported to limit inflammatory responses possibly by promoting regulatory T cell responses 46 or through NF-kB inhibition in chondrocytes 47. [score:4]
A combination of top 5 significantly different CIR-miRNAs (miR-30d-5p, miR-30a-5p, miR-192-5p, miR-26a-5p and miR-23a-5p) was sufficient to achieve discrimination of severe sepsis from non-infective SIRS patients (Fig. 3C). [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
For example, miR-148a and miR-143 are highly expressed in both bovine and goat mammary glands during lactation [49]; miR-148a and miR-26a have been shown to demonstrate consistent expression patterns in bovine milk throughout the lactation period [50] and miR-21-5p increased in expression remarkably at fresh period compared with dry period [23]. [score:6]
Six (bta-miR-148a, miR-26a, miR-21-5p, miR-27b, le-7f and let-7a-5p), four (bta-miR-30a-5p, miR-26a, miR-21-5p and let-7a-5p) and five (bta-miR-148a, miR-26a, let-7a-5p, miR-143 and miR-21-5p) of the highly expressed miRNAs in our study are also among the top 10 highly expressed miRNAs detected respectively in bovine mammary epithelial cells (MAC-T) [43] and lactating glands [24, 48]. [score:5]
[1 to 20 of 2 sentences]
96
[+] score: 11
Overexpression of SMAD-1 and SMAD-4 was inducible with anti-miR-26a treatment. [score:3]
Thus, miR-26 regulation in aneurysmal tissue with AAA development may in fact be causal, and not compensatory. [score:3]
Employing in vitro experiments with human aortic SMCs, Leeper and colleagues [60] found that miR-26a promotes the synthetic phenotype through regulation of SMAD1 and SMAD4, contributing to the regulatory circuit of TGF-β signaling -associated pathways. [score:3]
In two mouse mo dels of aneurysm formation (PPE- and AngII-infusion), miR-26 levels were decreased, which might contribute to AAA formation through enhanced SMC apoptosis. [score:1]
4.2. miR-26a. [score:1]
[1 to 20 of 5 sentences]
97
[+] score: 11
Other miRNAs from this paper: hsa-let-7b, hsa-mir-31, hsa-mir-26a-2, hsa-mir-506
Recent studies that used colon cancer cell lines have reported that EZH2 expression was inversely associated with microRNA-506 [38], microRNA-26a, and let-7b [39]; these microRNAs downregulated EZH2 expression by directly targeting 3′-UTR. [score:11]
[1 to 20 of 1 sentences]
98
[+] score: 11
”, miRiaD will detect the connection between mir-26a and its aspect, downregulation; between the disease osteosarcoma and its aspect, tumor metastasis; and between “miR-26a downregulation” and the disease entity of “tumor metastasis in osteosarcoma”. [score:11]
[1 to 20 of 1 sentences]
99
[+] score: 11
In particular, we identified two selective miRNA lists: the first one, composed by miR-150, miR-130b, miR-141, miR-29b, miR-26a, miR-34a and miR-200c, able to target the ZEB1 gene; and the second one, composed by miR-150, miR-221, miR-21 and miR-25, able to target the TP53 gene. [score:5]
Therefore, we can conclude that the B cell maturation step allowing the entrance in peripheral lymphoid organs induces the upregulation of a restricted group of miRNAs: miR-29a, miR-29b, miR-29c, miR-26a and miR-221. [score:4]
In addition, among miRNAs expressed at higher level in CD5 [−] B cells compared to CD5 [+] B cells, we identified five miRNAs: miR-29a, miR-29b, miR-29c, miR-26a and miR-221. [score:2]
[1 to 20 of 3 sentences]
100
[+] score: 11
First, miR-101 is located in the genomic loci with a high frequency of allelic losses in several types of cancers, and the down-regulation of miR-101 has been found in a variety of human malignancies including ESCC [26, 45– 61] Second, in our previous study, we found that COX-2 has an important effect on the proliferation and metastasis of ESCC [20– 23, 33, 62– 63]; in our preliminary experiment, among four putative miRNAs (miR-101, miR-143, miR-26a and miR-144) that could bind to the 3 ‘-UTR of COX-2 predicted by at least five databases (as shown above), only miR-101 could inhibit both the proliferation and metastasis of ESCC. [score:6]
Previously, we searched seven databases (Targetscan, Pictar, MiRanda, MiRwalk, Dianamt, Ebi and Microrna) and found four putative miRNAs that could bind to the 3 ‘- untranslated region (UTR) of COX-2 (according to at least five databases), which are miR-101, miR-144, miR-26a and miR-143. [score:5]
[1 to 20 of 2 sentences]