sort by

103 publications mentioning hsa-mir-32 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-32. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 359
TRAF3 protein level decreased sharply with the increase in Tat-C mediated upregulation of miR-32 (Figure  1b), suggesting that TRAF3 can be a direct target of miR-32 and that its expression can be modulated by changes in miR-32 expression. [score:11]
We found that the regulation of interferon regulatory factor 3 (IRF3) and IRF7 is controlled by cellular levels of TRAF3 protein in microglial cells, as after overexpression of miR-32 and application of anti-miR-32, expression levels of IRF3 and IRF7 were inversely regulated by expression levels of TRAF3. [score:10]
Downregulation of TRAF3 after Tat C treatment and miR-32 overexpression, and increased levels of phosphorylation of IRF3/7 suggest a negative regulatory role of TRAF3 in controlling IRF3 and IRF7 expression, which is in accordance with previously shown function of TRAF3 [27]. [score:9]
In response to HIV-1 Tat C exposure of human microglial cells, miR-32 was upregulated, consequently downregulating the protein level of TRAF3 post-transcriptionally by binding to its 3′ untranslated region. [score:9]
This suggests that anti-miR-32 could nullify the effect of Tat C -mediated upregulation of miR-32, and subsequent suppression of TRAF3 expression. [score:8]
Figure 8 Recovery of tumor necrosis factor receptor -associated factor 3 (TRAF3) expression by anti-miR-32 transfection suppresses expression levels of total interferon regulatory factor (IRF)3 and IRF7. [score:8]
qPCR analysis confirmed the change in TRAF3 transcription after miR-32 overexpression in CHME3 cells (Figure  4D) Thus, miR-32 was found to target TRAF3, suggesting a direct link between expression of miR-32 and TRAF3. [score:8]
The miR-32 target binding sites in the 3′ untranslated region (UTR) of human TRAF3 transcripts were identified with TargetScan Human software as above. [score:7]
We found a reduction in protein expression and mRNA levels of TRAF3 after Tat C treatment, as well as reduction in the expression of TRAF3 protein as a consequence of miR-32 overexpression (Figure  4A). [score:7]
The complementary interaction between miR-32 and TRAF3 mRNA results in translational inhibition, leading to reduced expression of TRAF3 protein in CHME3 cells exposed to HIV-1 Tat C protein. [score:7]
Figure 4 Overexpresssion of miR-32 suppresses tumor necrosis factor receptor -associated factor 3(TRAF3) protein expression. [score:7]
To assess whether changes in miR-32 expression levels after Tat C treatment involve the miRNA biogenesis machinery, we assessed the expression of Dicer and Drosha, and found no significant changes in their expression (Figure  3b), indicating that the Tat protein does not modulate the miRNA biogenesis machinery in CHME3 cells. [score:7]
HIV-1 Tat C exposure leads to the upregulation of miR-32, which targets TRAF3 and regulates it post-transcriptionally. [score:7]
When miR-32 was overexpressed, the levels of TRAF3 mRNA and protein were downregulated in CHME3 cells (Figure  4). [score:6]
We found that tumor necrosis factor-receptor–associated factor 3 TRAF3) is a direct target for miR-32, and overexpression of miR-32 in CHME3 cells decreased TRAF3 both at the mRNA and the protein level. [score:6]
The miRNA inhibitor against miR-32, ant-miR-32, reduced the cellular level of miR-32 and rescued the expression level of TRAF3 protein. [score:5]
A gradual increase in miR-32 expression levels was seen after Tat C treatment in a dose -dependent manner, with a 2.2-fold change in miR-32 expression seen in cells treated with 100 ng/ml of Tat C protein, and a 4.4-fold increase in cells treated 2.5 μg/ml of Tat C (Figure  1a). [score:5]
As a consequence of Tat C treatment and miR-32 overexpression, the transcript expression levels of IRF3 and IRF7 increased. [score:5]
miR-32 can regulate TRAF3 at the post-transcriptional level, through direct targeting of the TRAF3 3′ UTR. [score:5]
The presence of complementary binding sites in the 3′ UTR of TRAF3 mRNA for miR-32 is most likely the way in which overexpression of miR-32 resulted in reduced expression of TRAF3. [score:5]
To verify the specificity of miR-32 targeting to TRAF3 mRNA and blockage of translation, the level of cellular miR-32 was blocked by transfecting cells with anti-miR-32. [score:5]
This observation particularly revealed the inhibitory function of miR-32 on the expression of TRAF3. [score:5]
miR-32 expression was found to be 7.5-fold higher in miR-32 -overexpressed cells. [score:5]
Both;the Tat C treatment and miR-32 overexpression increases the IRF3 and IRF7 expression at the transcript level (Figure  9A,B). [score:5]
miR-32 overexpression was performed by transfecting the miRNA expression plasmid (SC400329; Origene Technologies, Rockville, MD, USA) using transfection reagent (11668–019; Lipofectamine 2000; Invitrogen Corp. [score:5]
Tat C -mediated miR-32 overexpression induced the expression levels of IRF3 and IRF7, indicating the correlation of reduced TRAF3 with increase in IRF3/7. [score:5]
The suppression of cellular miR-32 by using anti-miR-32, resulted in the reduced expression of both IRF3 and IRF7 at the transcript level (Figure  9C). [score:5]
The changes in expression levels of TRAF3 mediated by miR-32 resulted in changes in the expression pattern of cellular IRF3 and IRF7, which might lead to changes in interferon stimulatory genes. [score:5]
Thus, HIV-1 Tat C protein can modulate the innate immune response by affecting the expression level of IRF3/7 operating via the TRAF3 expression level under the control of miR-32. [score:5]
Using bioinformatic prediction tools (Pictar, TargetScan), we found that TRAF3 is a putative target of miR-32. [score:5]
In the present study, we found that the expression of TRAF3 decreased along with the increase in phosphorylated forms of IRF3 and IRF7 and levels of total IRF3 and total IRF7 after Tat C treatment or miR-32 overexpression. [score:5]
The overexpression of miR-32 (7.5-fold higher) led to a 60% reduction in the TRAF3 expression level compared with the cells transfected with empty vector. [score:4]
Figure 6 miR-32 directly targets the 3′-UTR of tumor necrosis factor receptor -associated factor 3 (TRAF3). [score:4]
In this study, we found that the expression of cellular TRAF3 protein in human microglial cells exposed to HIV-1 Tat C protein was regulated by cellular miR-32. [score:4]
Recovery of TRAF3 protein expression after transfection of anti-miR-32 and the results of the luciferase reporter assay provided direct evidence of TRAF3 regulation by miR-32. [score:4]
Phosphorylated (p)IRF3 level increased after anti-miR-32 treatment, while the total IRF3 level was downregulated in anti-miR-32 -transfected cells, showing a positive relationship between cellular TRAF3 level and activation of IRF3. [score:4]
This experiment was carried out to test the specificity of miR-32 -mediated downregulation of TRAF3. [score:4]
By using a luciferase reporter assay, we showed that TRAF3 is indeed a direct target for miR-32. [score:3]
The objective was to block the effects of miR-32 expression, which would confirm that these effects were due solely to the presence of miR-32. [score:3]
A pCMV-miR-32 construct encoding miR-32 was transfected into CHME3 cells, and the expression level of miR-32 was determined after 24 hours of transfection. [score:3]
The reciprocal relationship between increased miR-32 levels and reduced TRAF3 expression during Tat C exposure on CHME3 cells suggested an interaction between miR-32 and TRAF3. [score:3]
Luciferase expression was unaffected by using a mutated TRAF3 3′ UTR construct co -transfected with miR-32. [score:3]
Therefore, we investigated expression of TRAF3 protein in miR-32 -transfected CHME3 cells to establish a correlation between the expression level of miR-32 and that of TRAF3 protein. [score:3]
After 24 hours of anti-miR-32 transfection, a set of transfected cells were treated with 500 ng/ml Tat C protein to augment the cellular expression level of miR-32. [score:3]
The targeting of miR-32 for the 3′ UTR of TRAF3 was specific as shown by the parallel experiment, in which irrelevant miR-146 was not able to affect the luciferase level. [score:3]
In another gain-of-function study of TRAF3, anti-miR-32 was transfected into CHME3 cells to assess the expression levels of phosphorylated forms of IRF3/7 and total IRF3/7. [score:3]
Both the wild-type (WT) and mutant 3′ UTR of TRAF3 were transfected along with miR-32 expression clones in HeLa cells. [score:3]
The TRAF3 3′ UTR construct in pMirTarget (SC206836; Origene Technologies) and miR-32 construct as pCMV-Mir (SC400329; Origene Technologies) were used. [score:3]
CHME3 cells were transfected with anti-miR-32 (an miRNA inhibitor) along with a scrambled Cy3-labeled anti-miR-32 as negative control. [score:3]
Exposure of CHME3 cells to HIV-1 Tat C protein increased the expression level of cellular miR-32, accompanied by depletion of TRAF3 at protein level. [score:3]
Tat C treatment and miR-32 overexpression resulted in the same trend of activation of IRF3 and IRF7 (Figure  7). [score:3]
HIV-1 Tat-C treatment of human microglial cells resulted in a dose -dependent increase in miR-32 expression. [score:3]
org) were used to identify the potential targets of miR-32. [score:3]
miR-32 overexpression was confirmed by qPCR using TaqMan probes specific to miR-32. [score:3]
Blockage of cellular miR-32 by application of anti-miR-32 would have occupied the binding sites of mature miR-32, leaving the 3′ UTR of TRAF3 unrestricted, which resulted in enhanced protein expression. [score:3]
Figure 5 Anti-miR-32 transfection rescues tumor necrosis factor receptor -associated factor 3 (TRAF3) protein expression in CHME3 cells. [score:3]
In this experiment, luciferase reporter constructs was co -transfected with the miR-32 overexpression plasmid. [score:3]
This alteration in the 3′ UTR sequence of TRAF3 abrogated the interaction of miR-32 and the 3′ UTR of TRAF3, resulting in translational derepression. [score:3]
A mutation in the 3′ UTR of TRAF3 in miR-32 binding sites was created by deleting the TATT sequence at position 463 to 466 of the 3′ UTR using the primer set listed in Table  1. A site-directed mutagenesis kit (200518; Stratagene, La Jolla, CA, USA) was used for generating the deletion mutations. [score:3]
Total protein levels of IRF3 and IRF7 were also found to be higher in Tat C treated and miR-32 overexpressing CHME3 cells (Figure  7). [score:3]
with luciferase reporter clones of TRAF3 3′ UTR and a miR-32 -expressing plasmid. [score:3]
To investigate whether changes in miR-32 expression affect the levels of TRAF3 (Figure  1A), we assessed the expression level of cellular TRAF3 protein in HIV-1 Tat C -treated CHME3 cells. [score:3]
Changes in miR-32 expression level were significant (P ≤ 0.05). [score:3]
Expression levels of miR-32 were assessed by qPCR using miR-32 specific TaqMan probes. [score:3]
The expression levels of total IRF3, IRF7 and pIRF3/7 in CHME3 cells transfected with anti-miR-32 were analyzed by western blotting. [score:3]
Figure 1 Expression of miR-32 increases with Tat C treatment in a dose -dependent manner. [score:3]
CHME3 cells were treated with increasing dose of Tat-C protein to study the dose -dependent effect of Tat protein on miR-32 expression levels. [score:3]
This study is the first, to our knowledge, to report that TRAF3 is targeted by miR-32. [score:3]
Western blot analysis showed higher levels of phosphorylated IRF3 and IRF7 in Tat C -treated cells (Figure  7A,B) and a similar trend was seen in cells overexpressing miR-32. [score:3]
The empty construct without 3′ UTR of TRAF3, was simultaneously transfected with miR-32 overexpression plasmids as a negative control. [score:3]
TRAF3 protein expression in cells transfected with anti-miR-32 was analyzed using western blotting with anti-TRAF3 antibody (ab76147; Abcam, Cambridge, MA, USA). [score:3]
Figure 7 Phosphorylated state and total interferon regulatory factor (IRF)3 and IRF7 changes in CHME3 cells treated with TatC and transfected with miR-32. [score:2]
The increase in miR-32 expression was confirmed by qPCR of miR-32, compared with CHME3 cells transfected with the empty vector (Figure  4b). [score:2]
miR-32 overexpression significantly reduced both mRNA and protein levels of TRAF3 (P ≤ 0.05) (indicated by * in the transfected group) compared with empty vector. [score:2]
Expression levels of total IRF3 and IRF7 decreased (Figure  8A,B) in cells transfected with anti-miR-32, but phosphorylation of IRF3 and IRF7 increased compared with the scrambled anti-miR transfection (negative control). [score:2]
A deletion mutant was generated by site-directed mutageneis to modify the complementary sequence in the 3′ UTR of TRAF3 to abrogate the seven-mer match of the seed region of miR-32 and the TRAF3 3′ UTR. [score:2]
Figure 10 Proposed mo del for HIV-1 Tat C -induced, miR-32 -mediated post-transcriptional regulation of tumor necrosis factor receptor -associated factor 3 (TRAF3). [score:2]
The expression level of miR-32 decreased by 40% in cells transfected with anti-miR-32; compared to cells transfected with scrambled anti-miR negative control (* P ≤ 0.05). [score:2]
Further, recovery of TRAF3 via anti-miR32 transfection resulted in decreased IRF3/7 at both at the mRNA and (Figure  9) and protein levels (Figure  8). [score:1]
After 24 hours of miR-32 transfection, cells were harvested and lysed for protein samples and RNA isolation. [score:1]
When TRAF3 protein levels are reduced in HIV-1 Tat C treated and miR-32 -transfected cells, the repressive function of TRAF3 is removed, leading to activation of the non-canonical NF-κB pathway. [score:1]
The phosphorylated IRF3/7 levels were found to be significantly higher, than those of the control (Figure  8), but total IRF3 and total IRF7 protein levels were decreased in anti-miR-32 transfected cells (Figure  8). [score:1]
The complementary sequence in the TRAF3 3′ UTR was modified by deleting four bases (TATT) at positions 463 to 466 to remove the binding site for miR-32. [score:1]
This observation clearly supports the specificity of miR-32 binding to the TRAF3 3′ UTR in microglial cells. [score:1]
In cells treated with anti-miR-32 plus Tat C, the transcript levels of IRF3 and IRF7 were lower than those in control CHME3 cells. [score:1]
This effect can be simply attributed to enhanced cellular level of miR-32. [score:1]
The TRAF3 3′ UTR mutant did not show a significant reduction in luciferase activity when transfected with miR-32. [score:1]
Additionally, when anti-miR-32 -transfected cells were incubated with Tat C, the TRAF3 protein level was maintained at a higher level (Figure  5c). [score:1]
Total IRF7 level was decreased in anti-miR-32 -transfected cells showing that recovery of TRAF3 could modulate the transcription of IRF3and IRF7. [score:1]
Anti-miR-32 was transfected into CHME3 cells, and this was followed by Tat C treatment. [score:1]
This demonstrates that cellular TRAF3 level can be recovered with the help of an antagonist against miR-32. [score:1]
Another construct was generated having deletions in the predicted binding site in the 3′ UTR of TRAF3 complementary to the seed region of miR-32. [score:1]
Bioinformatic databases predicted that a conserved recognition sequence for miR-32 was present in the 3′ UTR of TRAF3 (Figure  6A). [score:1]
Knockdown of miR-32 in anti-miR transfected cells was assessed using an miR-32 assay. [score:1]
Plasmid pCMV-miR-32 was transfected into CHME3 cells. [score:1]
The level of miR-32 was 7.5-fold higher after transfection (P < 0.05) (Figure  4B). [score:1]
with 100 pmol of anti-miR-32 (AM12584; Ambion, Foster City, CA, USA) and Cy3-labeled control anti-miR (AM17011; Ambion). [score:1]
Anti-miR-32 transfection was performed at a concentration of 100 pmol/l. [score:1]
A significant reduction of up to 80% in the luciferase activity was seen when the TRAF3 3′ UTR was cotransfected with miR-32 (P ≤ 0.0005). [score:1]
In Tat C -treated and miR-32 transfected CHME3 cells, levels of phosphorylated IRF3 and IRF7 were higher. [score:1]
[1 to 20 of 100 sentences]
2
[+] score: 290
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, mmu-mir-24-1, mmu-mir-24-2, mmu-mir-32
In fact, the miR-32/vemurafenib combination worked as effectively in inhibiting tumor growth as the combination of sabutoclax and vemurafenib, likely because miR-32 and sabutoclax are equally effective at inhibiting MCL-1. Accordingly, there was no added therapeutic benefit from combining miR-32 with sabutoclax, which were equally effective individually at inhibiting MCL-1. Taken together, our results demonstrate that the loss of two tumor suppressors (miR-32 and ARF) in concert with overexpression of oncogenic MCL-1 represent key complementary drivers in melanomagenesis. [score:11]
miR-32 regulates the expression of MCL-1, PIK3R3, NRAS and signaling through the MAPK pathwayTo validate the predicted miR-targets, the 3’UTRs of NRAS, PIK3R3 and MCL-1, regulating luciferase reporter gene expression, were transfected into the WM3928 melanoma cell line (wildtype for both NRAS and BRAF). [score:9]
The data also suggest that melanoma’s recalcitrance to many forms of therapy may lie, at least in part, in its ability to circumvent apoptosis by downregulating ARF/ miR-32 and/or upregulating MCL-1. We posit that MCL-1 inhibition via miR-32 or sabutoclax can be effective therapy, alone or in combination with other agents, in a variety of human melanoma subtypes that currently have no effective treatment options available in the clinic. [score:9]
0165102.g002 Fig 2 miR-32 inhibits melanomagenesis in part by regulating the expression of the NRAS, PI3K and MCL-1. A, MCL-1 3’UTR harbors a well-conserved 8-mer binding site for miR-32 in exon 3. The miR-32 targets were predicted using a GOmiR algorithm [22]. [score:8]
In contrast, the miR-32 mimic had no effect on the expression level of reporter protein in cells overexpressing the mutant UTR, indicating that miR-32 -mediated regulation of NRAS was lost in mutant- NRAS 3’UTR -expressing cells. [score:8]
Malignant tumors frequently exhibited poor expression of miR-32, whose targets include NRAS, PI3K and notably, MCL-1. Accordingly, MCL-1 was often highly expressed in melanomas, and when knocked down diminished oncogenic potential. [score:8]
In contrast, cells overexpressing the mutant miR-32 mimic had no effect on the expression level of reporter protein, indicating that miR-32 -mediated regulation of MCL-1 was lost due to the mutation (Fig 2D). [score:7]
miR-32 was upregulated in normal tissue and downregulated in various human cancer types (Fig 3D). [score:7]
We utilized gene and microRNA (miRNA) expression data from INK4a - and ARF -associated melanoma mo dels, as well as available human melanoma databases, to uncover an important role for a pathway centered on the tumor suppressor miRNA miR-32 and the anti-apoptosis oncogene MCL-1. Moreover, our data suggest that their inhibition may be an effective anti-melanoma strategy, irrespective of the status of NRAS, BRAF or PTEN. [score:7]
We report here for the first time that miR-32 behaves as a tumor suppressor miRNA in melanoma by inhibiting the expression of MCL-1, as well as its upstream effectors NRAS and PI3K. [score:7]
Using a GOmiR algorithm [22] to integrate data from various target prediction algorithms, such as miRanda, TargetScan, PicTar4way, RNAhybrid, TraBase and PicTar5way, we discovered that miR-32 has a binding site in the 3’ UTRs of induced myeloid leukemia cell differentiation protein (MCL-1), an early critical negative regulator of apoptosis [23] (Fig 2A and S2 Table), as well as its upstream effectors NRAS and PIK3R3 (the regulatory subunit of PI3K). [score:7]
miR-32 inhibits melanomagenesis in part by regulating the expression of the NRAS, PI3K and MCL-1.. [score:6]
We also found that the miR-32 gene is highly conserved between species and frequently downregulated in human cancers and hence, can be a strong candidate tumor suppressor miRNA (see Fig 3 and S3 Fig). [score:6]
Overexpression of the miR-32 mimic led to down-regulation of luciferase protein driven by the NRAS, PIK3R3, and MCL-1 3’UTRs (Fig 2B). [score:6]
Accordingly, ectopic miR-32 overexpression in melanoma cells down regulated pMEK levels (Fig 2E) induced apoptosis (Fig 1C), and reduced anchorage-independent growth (Fig 2F) and tumor growth in vivo (Fig 2G), suggesting that miR-32 acts as a tumor suppressor by inducing apoptosis and reducing the tumorigenicity of melanoma cells. [score:6]
Hence the miR-32 gene, highly conserved between species and frequently downregulated in human cancers, including melanoma and is a strong candidate tumor suppressor miRNA. [score:6]
Overexpression of the miR-32 mimics in wildtype cells led to down-regulation of MCL-1 -associated activity (Fig 2D). [score:6]
The miR-32 is frequently downregulated in human cancers and is a strong candidate tumor suppressor miRNA. [score:6]
B, miRNA expression array was performed on NRAS-transformed ARF [-/-] and INK4a [-/-] melanocytes, which identified miR-32 as one of the top miRNAs upregulated in ARF-/- NRAS cells. [score:6]
Overexpression of the miR-32 mimics in cells containing the wildtype NRAS UTR led to down-regulation of reporter protein (Fig 2C). [score:6]
Hence, miR-32 -mediated regulation requires an intact miR-32 binding site in NRAS 3′UTR (Fig 2C), suggesting that NRAS expression is regulated by miR-32. [score:5]
MicroRNA-32 functions as a tumor suppressor and directly targets EZH2 in uveal melanoma. [score:5]
Here we validate the efficacy of miR-32 expression on inhibiting tumor growth, which was more effective than vemurafenib. [score:5]
In this study we integrated gene and microRNA (miRNA) expression data from genetically engineered mouse mo dels of highly and poorly malignant melanocytic tumors, as well as available human melanoma databases, and discovered an important role for a pathway centered on a tumor suppressor miRNA, miR-32. [score:5]
B, The 3’UTRs of NRAS, PIK3R3, MCL-1 and control-UTR (C-UTR, not regulated by miR-32) regulating luciferase reporter gene expression were transfected into the WM3928 melanoma cell line followed by transfection with miR-32 mimics. [score:5]
Hence, we conclude that MCL-1 expression is regulated by miR-32. [score:4]
E, miR-32 transcript expression is down regulated in several cancer types including melanoma in NCI 60 cancer cell line panel. [score:4]
A miRNA signature specifically associated with melanomagenesis mediated by ARF loss was identified, with miR-32 as one of the top miRNAs upregulated in NRAS-transformed ARF [-/-] cells; miRNA had not previously been implicated in melanoma (Fig 1B). [score:4]
Overexpression of miR-32 in NRAS-transformed ARF [-/-] malignant melanocytes induced apoptosis, suggesting a role for miR-32 in regulating cell survival (Fig 1C). [score:4]
A GO analysis of miR-32-predicted target genes identified apoptosis as one of the biological processes regulated by miR-32. [score:4]
A miR-32 transcriptomics analysis in NCI 60 cancer cell line panel using NCIs CellMiner database [25] revealed that miR-32 expression is down regulated in several cancer types including melanoma (Fig 3E). [score:4]
We found that miR-32 activity was significantly induced upon ARF re -expression, as evidenced by the fact that down regulation of the miR-sensing UTR was comparable to miR-32 transfected cells (Fig 1F). [score:4]
miR-32 is recently shown to target EZH2 and is down regulated in uveal melanoma [32]. [score:4]
miR-32 regulates the expression of MCL-1, PIK3R3, NRAS and signaling through the MAPK pathway. [score:4]
The oncogenic MCL-1 and its upstream effectors NRAS/PI3K are regulated by the tumor suppressor activity of both miR-32. [score:4]
We here identify miR-32/ MCL-1 pathway members as key early genetic events driving melanoma progression, and suggest that their inhibition may be an effective anti-melanoma strategy irrespective of NRAS, BRAF, and PTEN status. [score:3]
To confirm that the miR-32 target site in the 3’UTR of NRAS was a true site, we created a deletion mutant that completely abolished the seed region of the miR-32 binding site in the NRAS 3’UTR. [score:3]
The wildtype- NRAS 3′UTR (NRASwt) and mutant- NRAS 3’UTR (NRASmut) were transfected into WM3928 cells followed by transfection with miR-32 mimic and inhibitor. [score:3]
D, Wildtype- MCL-1 3′ UTR (MCL-1wt) and mutant- MCL-1 3’UTR (a miR-32 seed region deletion mutant in MCL-1 3’UTR, MCL-1mut) were transfected into WM3928 cells followed by miR-32 mimic and inhibitor transfection. [score:3]
miR-32 is a strong candidate tumor suppressor miRNA miR-32 is located on chromosome 9q31 (Fig 3A and S3 Fig) and is highly conserved between species (according to miRcode the miR-32 gene is conserved 89% among primates and 61% among mammals). [score:3]
miR-32 mimics were transfected into the WM3928 cells expressing the NRAS, PIK3R3, or MCL-1 3’UTRs. [score:3]
A, MCL-1 3’UTR harbors a well-conserved 8-mer binding site for miR-32 in exon 3. The miR-32 targets were predicted using a GOmiR algorithm [22]. [score:3]
A meta-analysis revealed that miR-32 was downregulated in 47 cancer data sets as compared to normal tissue. [score:3]
miR-32 is a strong candidate tumor suppressor miRNA. [score:3]
MCL-1 inhibition by miR-32 or by sabutoclax (Sab), alone or in combination, can be an effective anti-melanoma therapy. [score:3]
We went on to determine experimentally if the miR-32 target site in the 3’UTR of MCL-1 was a true site. [score:3]
miR-32 mimics were then transfected into wildtype- BRAF and mutant- NRAS 3′UTR -expressing WM3928 cells. [score:3]
Transfection efficiency was significantly high as measured by specific down regulation of miR-32 target genes. [score:2]
MCL-1 mRNA harbors two polyadenylation sites (PA1 and PA2) and the miR-32 binding site is located at the beginning of the MCL-1 3’UTR; therefore, miR-32 would be predicted to regulate all forms of MCL-1 mRNAs irrespective of polyadenylation site (Fig 2A and S2 Table). [score:2]
In this way miR-32 also helps regulate the RAS→RAF→MEK→ERF and PI3K→AKT→mTOR pathways. [score:2]
Based on its ability to regulate multiple key melanoma pathways, we anticipated that miR-32 treatment would be effective at reducing tumor growth in vivo. [score:2]
The microRNA/mRNA pair miR-32/ MCL-1 is deregulated in malignant melanoma. [score:2]
F, miR-32 transcript levels are expressed very low levels in primary and metastatic melanoma tumors as compared to melanocytes (C:control). [score:2]
The microRNA/mRNA pair miR-32/ MCL-1 is deregulated in malignant melanomaWe began our analysis using a simplified mo del in which we examined the behavior of INK4a -deficient and ARF -deficient mouse melanocytes infected with a retrovirus encoding oncogenic NRAS (NRAS [Q61K]), which is mutated in 20% of human melanomas [20, 21]. [score:2]
C, A miR-32 seed region deletion mutant was created using site-directed mutagenesis. [score:2]
Presumably, more dramatic effects on tumor cell growth would be obtained with additional doses of miR-32 and these drugs. [score:1]
A luciferase vector -based approach (miR-Sens-technology) was used to accurately detect miR-32 activity in these cells [24]. [score:1]
miR-32 replacement therapy and the MCL-1-specific antagonist sabutoclax were effective as single agents, and acted synergistically in combination with vemurafenib. [score:1]
A deletion mutant was created that completely abolished the seed region of the miR-32 binding site in the MCL-1 3’UTR. [score:1]
Treatment with miR-32 in combination with sabutoclax and vemurafenib caused a significant reduction in tumor size in the A375 melanoma xenograft mo del, resulting in a significant delay in melanoma tumor growth. [score:1]
Genomic and microRNAomic analysis identifies miR-32 and MCL-1 as critical players in melanomagenesis. [score:1]
Moreover, an analysis of miR-32 transcript levels in primary and metastatic melanoma tumors samples revealed that miR-32 is down regulated in primary and metastatic melanoma as compared to melanocytes (Fig 3F). [score:1]
Transfections of miR-32 and siRNAs. [score:1]
The MCL-1-specific antagonist sabutoclax and miR-32 were effective as single agents, and acted synergistically in combination with vemurafenib in preclinical melanoma mo dels. [score:1]
The MCL-1 3’UTR harbors a well-conserved 8-mer binding site for miR-32. [score:1]
0165102.g001 Fig 1Genomic and microRNAomic analysis identifies miR-32 and MCL-1 as critical players in melanomagenesis. [score:1]
F. miR-Sens- technology was used to detect miR-32 activity [24] using a miR-sensing UTR (with a miR-32 binding site) in ARF-/- cells. [score:1]
D, A mo del of the miR-32/ MCL-1 pathway in melanoma and perhaps other tumors is presented. [score:1]
A mutant UTR, where miR-32 site was deleted was used as a control. [score:1]
A375P melanoma cells were transfected with miR-32 and siMCL-1 and subcutaneously implanted at 0.5 X 10 [6] cells per injection site per mouse (experimental n = 5, control n = 10). [score:1]
Transfections of miR-32 and siRNAsMelanocytes were plated in six or 12 well plates and 24 h later transfected with 100nM of either miR-32, non-specific miRNA or MCL-1 siRNA using oligofectamine (Invitrogen) [16] according to the manufacturer's protocols. [score:1]
G, A375 control and miR-32 overexpressing cells were transplanted subcutaneously into immune compromised mice; tumor growth was measure at day 32. [score:1]
S3 Fig A, miR-32 is located on chromosome 9q31 (in the NR_029506.1 noncoding region) and is highly conserved between species (according to miRcode the miR-32 gene is conserved 89% among primates and 61% among mammals) B, miR-32 stem loop structure is presented. [score:1]
Importantly, both miR-32 replacement therapy and the MCL-1-specific antagonist sabutoclax demonstrated single-agent efficacy, and acted synergistically in combination with vemurafenib in preclinical melanoma mo dels. [score:1]
miR-32 is located on chromosome 9q31 (Fig 3A and S3 Fig) and is highly conserved between species (according to miRcode the miR-32 gene is conserved 89% among primates and 61% among mammals). [score:1]
Melanocytes were plated in six or 12 well plates and 24 h later transfected with 100nM of either miR-32, non-specific miRNA or MCL-1 siRNA using oligofectamine (Invitrogen) [16] according to the manufacturer's protocols. [score:1]
We also discovered that miR-32 pretreatment can potentiate the anti-tumor effects of sabutoclax and vemurafenib in vivo (Fig 6C). [score:1]
The miR-32 chromosomal location. [score:1]
These wt and mutant vectors were transfected into the WM3928 melanoma cell line, which was in turn transfected with miR-32 mimics. [score:1]
0165102.g006 Fig 6The MCL-1-specific antagonist sabutoclax and miR-32 were effective as single agents, and acted synergistically in combination with vemurafenib in preclinical melanoma mo dels. [score:1]
Dosage used were as follows: si:si MCL-1 (100nM), miR: miR-32 (100nM), V: vemurafenib (500nM), S: sabutoclax (500nM); combination treatment with miR+V: miR-32 (100nM) and vemurafenib (25nM); miR+S: miR-32 (100nM) and sabutoclax (25nM); S+V: sabutoclax (25nM) and vemurafenib (25nM); miR+S+V: miR-32 (100nM), sabutoclax (25nM) and vemurafenib (25nM). [score:1]
C, A chromosomal cytoband meta-analysis was performed on miR-32-cytoband-9q31using normal vs. [score:1]
C, miR-32 (miR) pretreatment potentiated the anti-tumor effects of sabutoclax (S) and vemurafenib (V) in combination in the A375 melanoma xenograft mo del (n = 5, control n = 10). [score:1]
Moreover, the combination miR-32 and vemurafenib was more effective than either vemurafenib or miR-32 treatment alone. [score:1]
After 24 hours cells were transfected with miR-32 mimics (100nM) using oligofectamine (Invitrogen) according to the manufacturer's protocols. [score:1]
Furthermore, the A375P melanoma xenograft mo del was also used to test whether miR-32 pretreatment can potentiate the anti-tumor effects of sabutoclax (S) and vemurafenib (V) in combination (n = 5, control n = 10, 0.5 X 10 [6] cells per mice). [score:1]
[1 to 20 of 86 sentences]
3
[+] score: 288
Moreover, the up-regulation of miR-32 suppressed apoptosis and promoted proliferation and migration, whereas down-regulation of miR-32 showed an opposite effect. [score:9]
According to the results of TargetScan and miRanda analysis, we identified FBXW7 as a target gene of miR-32 which was partly verified by the inhibition of FBXW7 mRNA expression in mimic -transfected MCF-7 cells in vitro. [score:9]
Two other studies showed that miR-32 suppresses osteosarcoma cell proliferation and invasion through regulating Sox9 expression [13] and promotes CRC cells proliferation, migration, and invasion and reduces apoptosis by targeting PTEN [14]. [score:8]
These data demonstrated that miR-32 can down regulate FBXW7 expression by directly targeting its 3′-UTR. [score:7]
These findings inferred that miR-32 promotes cell proliferation, migration, and suppresses apoptosis by inhibiting the expression of FBXW7. [score:7]
These results indicated that the expression of miR-32 was up-regulated in breast cancer. [score:6]
Moreover, it is believed that mature miR-32 has divergent effects on the development of cancer, such as the elevated expression of miR-32 significantly inhibits the proliferation, migration and invasion of the SGC-7901 gastric cancer cell line [12]. [score:6]
The effect of miR-32 on the migration of breast cancer cells was characterized by a wound-healing assay, which showed that up-regulation of miR-32 could significantly promote cell migration and down-regulation of miR-32 could suppress cell migration (Fig.   2e, f). [score:6]
Furthermore, our results imply that high expression of miR-32 may contribute to the development of breast cancer through targeting FBXW7. [score:6]
The miR-32 mimic, inhibitor, mimic -negative control (NC), inhibitor-NC and shFBXW7 oligo were obtained from GenePharma (Shanghai, China) and transfected into MCF-7 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:5]
After 48 h of miR-32 mimic, inhibitor or mimic-NC/inhibitor-NC transfection, MCF-7 cells were obtained, plated at 8 × 10 [4] cells/well in 24 well plates and cultured until they formed a confluent monolayer. [score:5]
Dual-luciferase reporter assays showed that miR-32 binds to the 3′-untranslated region of FBXW7, suggesting that FBXW7 is a direct target of miR-32. [score:5]
The miR-32 inhibitor group displayed lower OD values and cell proliferation was significantly suppressed in this group (Fig.   2d). [score:5]
a Expression levels of miR-32 were up-regulated in 20 breast cancer tissues when compared with adjacent normal tissues. [score:5]
Based on the information above, we demonstrated that miR-32 was highly expressed in both breast cancer tissues and cell lines, and promoted the proliferation and migration and suppressed apoptosis of breast cancer cells. [score:5]
Taken together, the present study suggests that miR-32 promotes proliferation and motility and suppresses apoptosis of breast cancer cells through targeting FBXW7. [score:5]
MCF-7 cells (1 × 10 [5]) were plated into 6-well plates and transfected with miR-32 mimic/inhibitor or mimic-NC/inhibitor-NC. [score:5]
a, b MiR-32 mimic suppresses MCF-7 cell apoptosis and miR-32 inhibitor induces cell apoptosis. [score:5]
In addition, miR-32 induced down-regulation of FBXW7 and regulated the proliferation, migration and apoptosis capability of breast cancer cells. [score:5]
c The expression level of miR-32 was up-regulated in MCF-7 and MDA-MB-231 cell lines when compared with MCF-10A. [score:5]
a, b QRT-PCR of miR-32 expression in mimic/inhibitor or NC transfected MCF-7 cells. [score:5]
These findings indicate that miR-32 may serve as a tumor gene in breast cancer, at least partly via directly targeting FBXW7, and may therefore act as a potential candidate for miRNA -based therapy against breast cancer. [score:4]
Furthermore, we identified FBXW7 as a direct target of miR-32 in breast cancer cell lines. [score:4]
Moreover, we verified that miR-32 directly targeted FBXW7 through binding to the FBXW7-3′-UTR. [score:4]
MiR-32 mimic promotes cell proliferation and inhibitor suppresses cell growth. [score:4]
Xu JQ Zhang WB Wan R Yang YQ MicroRNA-32 inhibits osteosarcoma cell proliferation and invasion by targeting Sox9Tumour Biol. [score:4]
Recently, miR-32 has been identified as an important regulator in tumorigenesis and it may act as a tumor suppressor or an oncogene in different cancers [12– 14]. [score:4]
Down-regulation of miR-32 had the opposite effect (Fig.   3b). [score:4]
Wu W Yang J Feng X Wang H Ye S Yang P Tan W Wei G Zhou Y MicroRNA-32 (miR-32) regulates phosphatase and tensin homologue (PTEN) expression and promotes growth, migration, and invasion in colorectal carcinoma cellsMol Cancer. [score:4]
Fig.  3Effects of miR-32 expression on apoptosis in breast cancer cells. [score:3]
d Western blot analysis of FBXW7 protein levels in miR-32 overexpressing and NC cells. [score:3]
c, d MTT analysis of MCF-7 growth following transfection with miR-32 mimic/inhibitor or NC. [score:3]
The correlation between miR-32 expression levels and clinical pathological characteristics are summarised in Table  1. In all specimens tested, we found an inverse correlation between the expression of miR-32 and the level of FBXW7 mRNA (Fig.   1b, r = −0.431, P = 0.0248). [score:3]
Bioinformatic analyses predicted that FBXW7 was a potential target of miR-32. [score:3]
Whereas depletion of FBXW7 restored the apoptotic response in miR-32-inhibiting MCF-7 cells (Fig.   6c). [score:3]
In the present study, we have demonstrated that the expression of miR-32 was increased in the majority of breast cancer tissues and in breast cancer cell lines. [score:3]
MiR-32 was sufficiently strong enough to inhibit FBXW7 via direct binding to the FBXW7 3′-UTR region. [score:3]
Pearson’s correlation was used to estimate the relationship between expression levels of miR-32 and FBXW7 mRNA. [score:3]
The dual luciferase assay further confirmed that FBXW7 was a direct target of miR-32. [score:3]
Moreover, FBXW7 mRNA levels in breast cancer cases were inversely correlated with miR-32 expression. [score:3]
The 3′-UTR of FBXW7 mRNA which contains a putative target region for miR-32, was amplified from genomic DNA by PCR. [score:3]
NC, miR-32 inhibitor and FBXW7 shRNA oligo were transfected independently or simultaneously into MCF-7 cells. [score:3]
Fig.  2Effect of miR-32 expression on growth and migration in breast cancer cells. [score:3]
Furthermore, an inverse correlation was found between the expressions of miR-32 and FBXW7 mRNA levels in breast cancer tissues. [score:3]
Expression of miR-32 is greatly increased in breast cancer tissues and cell lines. [score:3]
Altogether, our findings suggested that miR-32 promotes cell growth and migration of breast cancer cells, at least in part, by targeting FBXW7. [score:3]
However, we failed to find a correlation between miR-32 and PR, ER and HER2 expression in the tissues of breast cancer patients, the reason might be that miR-32 has nothing to do with the involved molecular pathways of ER and PR. [score:3]
The luciferase assay showed that miR-32 remarkably down-regulated the luciferase activity of the FBXW7-wt construct, while the luciferase activity of FBXW7-mut in MCF-7 cells was unchanged (Fig.   4b). [score:3]
FBXW7 is a novel target gene of miR-32 in MCF-7 cells. [score:3]
As comprehensive data on miR-32 expression is currently unavailable, further studies are needed to reveal the exact role of miR-32 in breast cancer and subtypes in much larger populations. [score:3]
However, the proliferation and migration of MCF-7 cells were restored after co-transfection with miR-32 inhibitor. [score:3]
Further functional analysis suggested the involvement of miR-32 in the progression of breast cancer, and forced expression of miR-32 significantly promoted proliferation and migration as well as repressed cell apoptosis in breast cancer cell line MCF-7. Our results reveal that miR-32 may act as a tumor promoter to participate in the progression of breast cancer. [score:3]
We found an inverse correlation between the expression of miR-32 and the level of FBXW7 mRNA in breast cancer tissues. [score:3]
In conclusion, the present study assessed the expression and functions of miR-32 in breast cancer. [score:3]
c The relative expression of FBXW7 in miR-32 mimic transfected group and NC group. [score:3]
b In 19 breast cancer tissues and corresponding adjacent non-tumor tissues, miR-32 has a negative correlation with FBXW7 mRNA expression. [score:3]
Western blot analysis showed that over -expression of miR-32 reduced FBXW7 protein level. [score:3]
MiR-32 inhibits apoptosis of breast cancer cells. [score:2]
In this study, we described the biological significance and the effects of miR-32 dysregulation on cell proliferation, migration and apoptosis in human breast cancer cells. [score:2]
These results suggested that miR-32 may affect apoptotic pathways in regulating tumorigenicity. [score:2]
a The proliferation rate of MCF-7 cells were detected through at different time periods after transfection of miR-32 inhibitor and FBXW7 shRNA independently or simultaneously compared with NC group. [score:2]
e, f Wound-healing assay showing that gain of miR-32 promotes cell migration and loss of miR-32 suppresses cell migration. [score:2]
As shown in Fig.   3a, apoptosis in miR-32 mimic transfected cells was significantly inhibited when compared with the NC group. [score:2]
Zhang J Kuai X Song M Chen X Yu Z Zhang H Mao Z MicroRNA-32 inhibits the proliferation and invasion of the SGC-7901 gastric cancer cell lineOncol Lett. [score:2]
MiR-32 was frequently overexpressed in breast cancer tissue samples and cell lines as was demonstrated by qRT-PCR. [score:2]
As shown in Fig.   1a, miR-32 expression was greatly increased in 20/27 breast cancer tissues when compared with adjacent non-tumor tissues (74.07%, P < 0.05). [score:2]
MiR-32 Breast cancer FBXW7 Proliferation Apoptosis Breast cancer is one of the most common malignant diseases in women around the world and can be seriously harmful to women’s health and survival [1– 3]. [score:2]
For example, miR-32 in lung cancer is significantly down regulated [28], on the contrary, in renal and prostate cancer tissue the level of miR-32 is significantly raised and associated with the prognosis of patients [29, 30]. [score:2]
As shown in Fig.   4c, d, FBXW7 expression was significantly decreased in miR-32 mimic transfected cells when compared with the NC group whatever the mRNA or protein level. [score:2]
Previous studies have shown that miR-32 was dysregulated in breast cancer although its biological roles remain unclear [15, 16]. [score:2]
Fig.  6The effect of FBXW7 depletion on miR-32 -mediated breast cancer chemoresistance. [score:1]
Taken together, miR-32 is able to promote the proliferation and migration of breast cancer cells in vitro. [score:1]
Then, we found that MCF-7 cells exhibited distinct responses to FBXW7, with regard to miR-32 -mediated anti-apoptotic effect. [score:1]
Interference of FBXW7 restored miR-32 -mediated breast cancer cell growth and migration. [score:1]
Co-transfection of the reporter vectors and miRNA (miR-32 mimic or mimic NC) was performed in MCF-7 cells using Lipofectamine 2000. [score:1]
As shown in Fig.   2c, cells transfected with miR-32 mimic showed significantly higher optical density (OD) values at 550 nm than the NC group from day 2 until day 4, in a time dependent manner. [score:1]
Next, these constructs were transfected into MCF-7 cells with miR-32 mimic or NC miRNA. [score:1]
Our data reflect the heterogeneous nature of tumors and indicate that miR-32 functions are tumor-specific. [score:1]
In conclusion, miR-32 may play a different role in different tumor types. [score:1]
A mutant form of FBXW7 mRNA 3′-UTR was generated through mutating the binding site of miR-32 (FBXW7-mut) (Fig.   4a). [score:1]
b The relative luciferase activity in miR-32 mimic group and NC group. [score:1]
In this study, quantitative RT-PCR was used to evaluate the expression levels of miR-32 in 27 breast cancer tissues, adjacent normal breast tissues and human breast cancer cell lines. [score:1]
Further functional analyses are also needed to validate the possible utility of miR-32. [score:1]
MCF-7 cells were transfected with FBXW7 shRNA or NC to further investigate whether the effect of miR-32 on cell proliferation, migration and apoptosis of MCF-7 cells was via targeting FBXW7 (Fig.   5b). [score:1]
It has been observed that high miR-32 levels were present in some tumor but low levels in others. [score:1]
a The miR-32 binding site in FBXW7 3′-UTR, located 286-292 bp upstream of the FBXW7 3′-UTR. [score:1]
In addition, the regulation of FBXW7 by miR-32 was assessed by qRT-PCR, Western blot and luciferase reporter assays. [score:1]
In order to evaluate the potential involvement of miR-32 in breast cancer, the expression level of miR-32 was detected in 27 breast cancer tissues and corresponding adjacent non-tumor tissues by real-time PCR. [score:1]
To validate whether miR-32 might mediate the decay of FBXW7 mRNA via the 3′-UTR, we subcloned FBXW7 mRNA 3′-UTR into psiCHECK™-2 luciferase reporter construct (FBXW7-wt). [score:1]
Real-time PCR detection of miR-32 was conducted as reported by Francesca Fornari et al. [24]. [score:1]
Our findings will help to elucidate the functions of miR-32 and its role in breast cancer tumorigenesis. [score:1]
The impact of miR-32 on cell proliferation and viability was analyzed by. [score:1]
[1 to 20 of 92 sentences]
4
[+] score: 224
In addition, the protein level of PTEN was also elevated by GAS5 overexpression; however, the GAS5 -induced increase in PTEN protein expression was suppressed markedly by miR-32-5p overexpression, suggesting that miR-32-5p negatively regulated the expression of PTEN and mediated the effect of GAS5 on PTEN expression (Fig.   5b). [score:14]
This finding was further confirmed by that miR-32-5p silencing combined with GAS5 down-regulation completely reversed the siRNA-GAS5 -mediated inhibition on PTEN expression both at mRNA and protein levels (Fig.   5c, d). [score:8]
As expected, GAS5 negatively regulated miR-32-5p expression, thereby promoting the expression of phosphatase and tensin homologue (PTEN), which is the confirmed target of miR-32-5p. [score:8]
The expression of miR-32-5p was markedly inhibited in GAS5-over-expressed tumor tissue, whereas both PTEN mRNA and protein levels were increased (Fig.   7b). [score:7]
GAS5 could positively regulate PTEN -induced tumor-suppressor pathway via miR-32-5p, thereby suppressing PC metastasis. [score:6]
In the present study, PTEN was indicated to down-regulate in PC tissues and cells, and could be elevated by GAS5 via inhibiting miR-32-5p. [score:6]
In addition, photodynamic therapy strongly down-regulated the expression miR-32-5p in oral cancer cells, but its roles in the therapeutic effect of photodynamic therapy are unknown [25]. [score:6]
PANC-1 and BxPC-3 cells were transfected with miR-32-5p inhibitor plus si-control or miR-32-5p inhibitor plus si-GAS5. [score:5]
PC cells PANC-1 and BxPC-3 were transfected with miR-32-5p inhibitor plus si-control or miR-32-5p inhibitor plus si-GAS5. [score:5]
NC The expression trend of PTEN, a downstream target of miR-32-5p, was similar to GAS5 both in human PC tissues and cells. [score:5]
The present study showed that GAS5 suppressed the proliferation, migration and invasion of PC cells through regulating miR-32-5p/PTEN axis. [score:4]
It was found that miR-32-5p inhibitor plus si-GAS5 had no significant influence on the viability, migration and invasion of PANC-1 and BxPC-3 cells compared with miR-32-5p inhibitor plus si-control (Additional file 3: Figure S2). [score:4]
Furthermore, GAS5 suppressed the proliferation, migration and invasion of PC cells through regulating miR-32-5p/PTEN axis. [score:4]
Our data revealed that miR-32-5p was highly expressed in human PC tissues and cell lines, indicating that miR-32-5p may contribute to the development of PC. [score:4]
We further compared PTEN levels between miR-32-5p inhibitor plus si-control and miR-32-5p inhibitor plus si-GAS5. [score:4]
Fig.  5GAS5 positively regulated the expression of PTEN through miR-32-5p. [score:4]
The co-transfection experiment was designed to investigate whether GAS5 could up-regulate the expression of PTEN by miR-32-5p. [score:4]
GAS5 regulated the expression of PTEN through miR-32-5p. [score:4]
As shown in Additional file 2: Figure S1, compared with miR-32-5p inhibitor plus si-control, miR-32-5p inhibitor plus si-GAS5 had no significant influence on PTEN levels in PANC-1 and BxPC-3 cells. [score:4]
Wu et al. found that miR-32 down-regulated anti-oncogene phosphatase and tensin homologue (PTEN), thereby contributing to the migration and invasion of colorectal carcinoma cells [15]. [score:4]
GAS5 positively regulated the expression of PTEN through miR-32-5p. [score:4]
To date, miR-32-5p was also reported to abnormally expressed in tumors and played important regulative roles [14]. [score:4]
Meanwhile, simultaneously overexpressing miR-32-5p and GAS5 greatly reversed the GAS5 -induced repression on PC cells (Fig.   6a–c). [score:3]
The commercial miR-32-5p inhibitor and mimic were purchased from GenePharma (China). [score:3]
MiR-32-5p was down-regulated in blood from prostate cancer patients, and thus was expected to be a new indicator for prostate cancer diagnosis [14]. [score:3]
The expressions of miR-32-5p and PTEN in tumor tissue were detected after 28 days observation. [score:3]
si-GAS5 + NC The co-transfection of the expression vector of GAS5 and miR-32-5p was designed to investigate the role of miR-32-5p in the GAS5 -induced growth inhibition of PC cells. [score:3]
PTEN suppression by miR-32 was conducived to the proliferation and invasion of colorectal cancer cells. [score:3]
Whereas miR-32-5p was highly expressed in PC cells PANC-1 and BxPC-3 (Fig.   2b). [score:3]
Fig.  1The expression profile of GAS5, miR-32-5p and PTEN protein in pancreatic cancer (PC) tissue. [score:3]
Fig.  2The expression profile of GAS5, miR-32-5p and PTEN protein in PC cell lines. [score:3]
b The expression of miR-32-5p and PTEN in tumor tissue induced by PANC-1 cells was detected after 28 days observation. [score:3]
PANC-1 and BxPC-3 cells were cultured in 24-well plates and transfected with pcDNA-GAS5 (2 µg) or siRNA-GAS5 or miR-32-5p inhibitor (150 nM) or mimic (100 nM) or the appropriate negative control using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s instructions. [score:3]
Total RNA was reverse transcribed into cDNA using a miScript II RT Kit (Qiagen) for analysis of miR-32-5p expression, and the total RNA was applied in a cDNA Reverse Transcription Kit (Applied Biosystems) for detection of GAS5 and PTEN mRNA. [score:3]
GAS5 overexpression significantly abrogated PC cells tumorigenesis in vivo accompanied by decreased miR-32-5p and increased PTEN. [score:3]
qRT-PCR analysis of the relative expression of a GAS5 and b miR-32-5p in PC cell lines PANC-1 and BxPC-3, and normal human pancreatic duct epithelial cells HPDE6-C7. [score:3]
pcDNA A total of 22 human PC tissues and the adjacent normal tissues were collected for analysis of the expression profile of GAS5, miR-32-5p and PTEN protein in PC. [score:3]
c, d PC cells PANC-1 and BxPC-3 were transfected with si-GAS5 alone or with miR-32-5p inhibitor. [score:3]
The main new achievement of this study includes: (1) LncRNA GAS5 inhibited the migration and invasion of PC cells; (2) miR-32-5p was increased in PC tissues and cells, and was associated with the migration and invasion of PC cells; (3) we further explicitly confirmed the existence of GAS5/miR-32-5p/PTEN signaling pathway in pancreatic cancer cell metastasis. [score:3]
b qRT-PCR analysis of the relative expression of miR-32-5p in human PC tissues (n = 22). [score:3]
The relative expression of miR-32-5p was determined by using SYBR Green -based miScript PCR Array (Qiagen) according to the manufacturer’s instructions and normalized to U6. [score:3]
A total of 22 human PC tissues and the adjacent normal tissues were collected for analysis of the expression profile of GAS5, miR-32-5p and PTEN protein in PC. [score:3]
As shown in Fig.   5a, pcDNA-GAS5 significantly promoted the expression of PTEN mRNA in PANC-1 and BxPC-3 cells, but the level of PTEN mRNA aggressively reduced in PC cells transfected with pcDNA-GAS5 and miR-32-5p mimic. [score:3]
MiR-32-5p was significantly decreased in fatty acids -treated human colorectal adenocarcinoma cells accompanied by a decrease in BCL-2 and BCL2L11 expression [24]. [score:2]
adjacent normal tissues The expression changes of GAS5, miR-32-5p and PTEN protein in PC cells (PANC-1, BxPC-3) and normal human pancreatic duct epithelial cells HPDE6-C7 were also analyzed and compared. [score:2]
The expression changes of GAS5, miR-32-5p and PTEN in human PC specimens and cell lines were compared by means of molecular biology methods. [score:2]
As the specific regulation mechanism between lncRNA and miRNA is complex, further work is needed to clarify the precise interactions between GAS5 and miR-32-5p, which is also the focus of our subsequent research. [score:2]
Meanwhile, miR-32-5p expression was dramatically increased in PC tissues (n = 22) compared with the normal tissues (n = 22) (Fig.   1b). [score:2]
GAS5 regulated the viability, migration and invasion of PC cells through miR-32-5p. [score:2]
Combined with the results of bioinformatic analysis, we inferred that GAS5 may regulate the downstream molecules and signals of miR-32-5p by interacting with miR-32-5p that participates in the pathogenesis of PC. [score:2]
MiR-32-5p mediated the suppression of GAS5 on the viability, migration and invasion of PC cells. [score:2]
adjacent normal tissues The expression changes of GAS5, miR-32-5p and PTEN protein in PC cells (PANC-1, BxPC-3) and normal human pancreatic duct epithelial cells HPDE6-C7 were also analyzed and compared. [score:2]
pcDNA-GAS5 + miR-32-5p mimic PANC-1 cells were transfected with pcDNA or pcDNA-GAS5 and then 5 × 10 [6] cells suspended in 0.1 ml of PBS were injected in the posterior flank of the mice. [score:1]
a, b PC cells PANC-1 and BxPC-3 were transfected with pcDNA-GAS5 alone or with miR-32-5p mimic. [score:1]
The interaction between GAS5 and miR-32-5p in PC cells. [score:1]
Pancreatic cancer GAS5 miR-32-5p PTEN Pancreatic cancer (PC) is a malignant neoplasm in digestive tract with a high degree of malignancy, which is difficult to diagnose and treat [1]. [score:1]
PANC-1 and BxPC-3 cells were transfected with pcDNA or pcDNA-GAS5 or pcDNA-GAS5 + pre-NC or pcDNA-GAS5 + miR-32-5p mimic. [score:1]
MiR-32 has been confirmed to promote the proliferation and migration of breast cancer cells, but the specific role of miR-32-5p in PC remains unknown [23]. [score:1]
b was performed to observe the position relation between GAS5 and miR-32-5p. [score:1]
c was used to further explore the interaction between GAS5 and miR-32-5p. [score:1]
We therefore inferred that GAS5 was involved in PC metastasis through modulating miR-32-5p/PTEN axis. [score:1]
Consistent with this, revealed that miR-32-5p could interact with GAS5 in PANC-1 cells possibly through a sequence-specific manner (Fig.   4c, d). [score:1]
The effect of GAS5 and miR-32-5p on PC progression was assessed with cell proliferation, migration, invasion and apoptosis in vitro. [score:1]
Fig.  4The interaction between GAS5 and miR-32-5p. [score:1]
These findings collectively suggested that miR-32-5p mediated the effect of GAS5 on the viability, migration and invasion of PC cells. [score:1]
The level of Ago2 protein in the eluted complex was analyzed by western blotting, and the miR-32-5p level was determined by qRT-PCR according to the standard procedures. [score:1]
a The putative binding sites between GAS5 and miR-32-5p. [score:1]
The precipitated RNAs were isolated and reverse transcribed in cDNA to analyze GAS5 and miR-32-5p level using qRT-PCR. [score:1]
In this study, we confirmed the existence of GAS5/miR-32-5p/PTEN signaling pathway in pancreatic cancer cell metastasis. [score:1]
pcDNA The bioinformatics analysis revealed potential combination of GAS5 and miR-32-5p, the putative binding sites as shown in Fig.   4a. [score:1]
PC cells PANC-1 and BxPC-3 were divided into four groups: pcDNA, pcDNA-GAS5, pcDNA-GAS5 + pre-NC, pcDNA-GAS5 + miR-32-5p mimic. [score:1]
Our results firstly identified that miR-32-5p was increased in PC tissues and cells, and was associated with the migration and invasion of PC cells. [score:1]
In view of the findings, we were interested in that whether miR-32-5p promoted PC metastasis via modulating PTEN level. [score:1]
In a further RIP experiment, GAS5 and miR-32-5p simultaneously existed in the production precipitated by anti-AGO2 (Fig.   4b). [score:1]
After the last measurement, the mice were executed, and all tumor tissues were dissected from the mice for analysis of the expression level of miR-32-5p and PTEN. [score:1]
The bioinformatics analysis (online systems) showed that the binding site of GAS5 also existed in miR-32-5p, suggesting a potential interaction between GAS5 and miR-32-5p. [score:1]
GAS5 and PTEN protein were decreased in human PC tissues and cells, but miR-32-5p was increased. [score:1]
[1 to 20 of 77 sentences]
5
[+] score: 102
e and f The ectopic expression of miR-32-5p and miR-92b-3p suppressed the endogenous expression of mRNA and proteins. [score:7]
According to the aforementioned criteria, miR-32-5p and miR-92b-3p might suppress IDH1 expression by targeting its 3′-UTR. [score:7]
Furthermore, oncogenic miR-32 and miR-92b were identified to suppress IDH1 expression, leading to the inhibition of cell migration and invasion. [score:7]
Furthermore, the ectopic expression of miR-32-5p and miR-92b-3p suppressed the mRNA and protein expression of IDH1 in breast cancer cells (Fig. 3e and f). [score:7]
Two novel micro RNAs (miRNAs), miR-32-5p and miR-92b-3p, were identified to directly inhibit IDH1 expression. [score:6]
We first reported that the loss of IDH1 expression resulted from the aberrant overexpression of miR-32-5p and miR-92b-3p in breast cancer. [score:5]
Oncogenic miR-32-5p and miR-92b-3p suppressed IDH1 expression to enhance invasion ability in breast cancer. [score:5]
Therefore, the expression levels of the predicted candidates were examined using TCGA database, showing that miR-32-5p and miR-92b-3p expression was significantly higher (fold change > 2) in breast cancer tissues (n = 778) compared with adjacent normal tissues (n = 87; Fig. 3b). [score:4]
Xia H Long J Zhang R Yang X Ma Z MiR-32 contributed to cell proliferation of human breast cancer cells by suppressing of PHLPP2 expressionBiomed Pharmacother. [score:4]
luminal A) by multivariate Cox regression Bold italic values denote statistically significantIn summary, we observed that miR-32-5p and miR-92b-3p overexpression resulted in tumor-suppressive IDH1 silencing in breast cancer tissues compared with that in adjacent normal tissues. [score:4]
In summary, the aberrant overexpression of oncogenic miR-32-5p and miR-92b-3p resulted in the reduction of IDH1 by directly binding at the 3′-UTR of IDH1 to promote invasion in breast cancer cells. [score:4]
Xia W Zhou J Luo H Liu Y Peng C Zheng W Ma W MicroRNA-32 promotes cell proliferation, migration and suppresses apoptosis in breast cancer cells by targeting FBXW7Cancer Cell Int. [score:4]
luminal A) by multivariate Cox regression Bold italic values denote statistically significant In summary, we observed that miR-32-5p and miR-92b-3p overexpression resulted in tumor-suppressive IDH1 silencing in breast cancer tissues compared with that in adjacent normal tissues. [score:4]
The ectopic expression of miR-32-5p or miR-92b-3p significantly accelerated the invasion ability of breast cancer cells (Additional file 5: Figure S1c and d). [score:3]
The expression levels of miR-32-5p and miR-92b-3p were significantly higher in breast cancer tissues than in the adjacent normal tissues (miR-32-5p, p < 0.001 and miR-92b-3p, p < 0.001, respectively; Additional file 5: Figure S1a and b). [score:3]
The miR-32-5p and miR-92b-3p targeting sequence in 3’UTR sequence of IDH1 is shown in the upper panel and the mutant (mut) of its seed region is shown in red, respectively. [score:3]
The firefly luciferase activity was used as the normalization control We examined the expression levels of miR-32-5p and miR-92b-3p in breast cancer using a real-time PCR approach. [score:3]
As shown in Fig. 3i and j, miR-32-5p and miR-92b-3p significantly suppressed the luciferase activity of wild-type pMIR–IDH1-3′-UTR (wild-type), but not of mutated pMIR–IDH1-3′-UTR. [score:3]
c and d After transfecting MDA-MB-231 cells with miR-32-5p and miR-92b-3p mimics, the individual expression levels were examined using real-time PCR. [score:3]
The firefly luciferase activity was used as the normalization controlWe examined the expression levels of miR-32-5p and miR-92b-3p in breast cancer using a real-time PCR approach. [score:3]
To examine this notion, miR-32-5p and miR-92b-3p were ectopically expressed in MDA-MB-231 cells by transfecting them with miR-32-5p and miR-92b-3p mimics. [score:3]
Studies have indicated that miR-32-5p plays an oncogenic role in the growth and invasion ability of breast cancer cells by directly silencing PHLPP2 and FBXW7 [38, 39]. [score:2]
We provide a novel insight that miR-32-5p and miR-92b-3p dysregulation results in IDH1 depletion. [score:2]
As shown in Fig. 3c and d, the expression levels of miR-32-5p and miR-92b-3p were clearly increased in MDA-MB-231 cells transfected with the respective mimics compared with those transfected with scramble control (N. C). [score:2]
The relative luciferase activity of the reporter with wild-type and mutant 3′-UTR of IDH1 was determined in breast cancer cells co -transfected with miR-32-5p and miR-92b-3p mimic, respectively. [score:1]
Subsequently, pGL3–IDH1–3′-UTR vectors were co -transfected with miR-32-5p mimics, miR-92b-3p mimics, or scramble controls in breast cancer cells using the Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, USA). [score:1]
Oncogenic miRNAs, miR-32-5p, and miR-92b-3p accelerated breast cancer cell invasion. [score:1]
Breast cancer cells were transfected with 10-nM miRNA-32-5p mimics, miR-92b-3p mimics, or the appropriate miRNA mimic control (GenDiscovery Biotechnology Inc. [score:1]
[1 to 20 of 28 sentences]
6
[+] score: 91
Other miRNAs from this paper: hsa-mir-374a
Compared with the control group, the expression of miR-32 in the miR-32 -mimic group was significantly downregulated and in the miR-32 -inhibitor group significantly upregulated (P<0.05; Fig. 1C). [score:10]
miR-32 expression was upregulated and downregulated by various methods and dynamic biological changes were observed in the GC cells. [score:9]
The target prediction software miRanda, TargetScan and miRtarget were used to predict miR-32 targets and SMAD7, GATA6, MYH9 and SOX4 were identified. [score:9]
The results showed that high expression of miR-32 in the miR-32 -mimic group significantly inhibited cell proliferation compared with the miR-32 -inhibitor, control and untransfected groups (P<0.05; Table II). [score:6]
In conclusion, the present study confirmed that miR-32 notably impacts the biological behavior of GC cells and the upregulation of miR-32 markedly inhibits the proliferation and migration of GC cells. [score:6]
miR-32 and miR-374a, which were found to be upregulated significantly, were randomly selected to confirm the result of the miRNA expression chip by qPCR. [score:6]
By contrast, the suppressed expression of miR-32 led to a marked increase in cell proliferation and invasion ability. [score:5]
miR-32 eukaryotic expression vectors (mimic and inhibitor) were successfully constructed and SGC-7901 GC cells were transfected with these vectors. [score:5]
Expression of miR-32 in SGC-7901 cells transfected with miR-32 -mimic and -inhibitor. [score:5]
The results showed that, compared with the inhibitor and control groups (blank and empty vector controls), the miR-32 -mimic group inhibited cell proliferation and migration at 48 and 72 h following transfection (P<0.05). [score:4]
By contrast, the miR-32 -inhibitor group significantly increased the invasion ability (P<0.05) (Table I; Fig. 3). [score:3]
As a result, miR-32 was selected in the present study as the target gene to further study its effect on the biological behavior of GC cells. [score:3]
Therefore, miR-32 markedly inhibits the malignant behavior of SGC-7901 cells. [score:3]
Following the overexpression of miR-32 at 48 and 72 h, cell proliferation and invasion ability were examined and found to be markedly decreased. [score:3]
miR-32 inhibits cell proliferation. [score:3]
miR-32 inhibits the migration and invasion of SGC-7901 cells in vitro. [score:3]
The results showed that >80% cells were labeled with GFP and SGC-7901 cells had been successfully transfected with miR-32 -mimic and -inhibitor (Fig. 1A and B). [score:3]
However, the mechanisms by which CDX2 mediates the miR-32-altered phenotype of GC cells in vivo and in vitro, and which molecules miR-32 interacts with to regulate the phenotype of GC cells, remain to be solved in future studies. [score:2]
Therefore, CDX2 may mediate miR-32 to achieve its anticancer effect. [score:1]
The results showed that the migration ability of the miR-32 -mimic group (61.39±2.21 vs. [score:1]
Following transfection, the PCR reaction solution used to detect the relative expression levels of miR-32 in GC cells (SGC-7901) included the following: 12.5 μl SYBR-Green/ROX qPCR master mix, 1.5 μl forward and reverse primers (including primers for miR-32 and U6) and 1 μl template DNA. [score:1]
[1 to 20 of 21 sentences]
7
[+] score: 44
In multiple human cancers, PTEN expressions are downregulated by miRNAs, which are shown in Table 1. Table 1 miRNA Locus Expression status Tumor type Reference MiR-21 17q23.1 Upregulated Colorectal, bladder, and hepatocellular cancer[112– 114] MiR-19a 13q31.3 Upregulated Lymphoma and CLL[87, 115] MiR-19b Xq26.2 Upregulated Lymphoma[87] MiR-22 17p13.3 Upregulated Prostate cancer and CLL[116, 117] MiR-32 9q31.3 Upregulated Hepatocellular carcinoma[118] MiR-93 7q22.1 Upregulated Hepatocellular carcinoma[119] MiR-494 14q32.31 Upregulated Cervical cancer[120] MiR-130b 22q11.21 Upregulated Esophageal carcinoma[121] MiR-135b 1q32.1 Upregulated Colorectal cancer[122] MiR-214 1q24.3 Upregulated Ovarian cancer[123] MiR-26a3p22.2 (MIR26A1)12q14.1(MIR26A2) Upregulated Prostate cancer[113] MiR-23b 9q22.32 Upregulated Prostate cancer[114] Abbreviations: CLL, chronic lymphocytic leukemia. [score:44]
[1 to 20 of 1 sentences]
8
[+] score: 36
Whereas miR-182 and miR-375 were significantly overexpressed in PCa (P < 0.001 for both), confirming the results of the array, no significant differences were found for miR-32 expression between PCa and MNPT (Figure  1A and Additional file 2: Figure S1). [score:5]
Correlation analysis for miRNAs expression showed that miR-375 was significantly co-expressed with miR-32 and miR-182 (r = 0.36 and r = 0.60, respectively; Table  3 and Figure  3). [score:5]
However, miR-32 overexpression was not validated and expression of other miRNAs was found to be minimal or absent. [score:5]
Although miR-32 expression levels did not differ between PCa and MNPT in our dataset, the larger number of samples available at the TCGA demonstrated increased expression PCa compared to matched normal prostate tissues. [score:4]
Because several miRNAs were below detection level in quantitative reverse transcription-polymerase chain reaction (RT-qPCR) analyses (probably due to low expression levels), only three miRNAs (miR-32, miR-182, and miR-375) were assessed in the larger dataset. [score:3]
Expression of miR-32 and miR-182 is increased in prostate cancer in patients from TCGA. [score:3]
Validation of expression levels of (A) miR-32, (B) miR-182 (*** P < 0.001; ns, non-significant). [score:3]
Expression of three miRNAs, not previously associated with PCa, was subsequently assessed in large independent sets of primary tumors, in which miR-182 and miR-375 were validated, but not miR-32. [score:3]
Moreover, both miR-32 and miR-182 were overexpressed in PCa compared to matched normal prostate tissues (P < 0.0001; Additional file 3: Figure S4). [score:2]
Clinical and pathological data of patients included in this study for miR-32 and miR-182. [score:1]
MNPT) miR-449a# 3.92 miR-32 3.49 miR-548c-5p 2.71 miR-562 2.56 miR-103-as 2.53 miR-512-3p 2.41 miR-200c* 2.33 miR-147b 2.24 miR-770-5p 2.09 miR-518c* 2.00 miR-517b 1.88 miR-182 1.79 miR-615-3p 1.70 miR-496 1.59 miR-1200 1.58 miR-375 1.54 miR-551a 1.53 *Passanger strand. [score:1]
Figure 3miR-375 is significantly co-expressed with (A) miR-32 and (B) miR-182 in prostate cancer patients from TCGA (r calculated by Spearman’s correlations). [score:1]
[1 to 20 of 12 sentences]
9
[+] score: 31
Target onco/tumor suppressor genes Type of cancer Colon lung pancreas prostate APC 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a EP300 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a DNMT1 17-5p, 32, 106a MSH3 17-5p, 20a, 106a RB1 17-5p, 20a, 106a HOXB4 17-5p, 20a, 106a RECK 21, 106a, 155 ETV1 17-5p, 20a,106a SYT7 17-5p, 20a,106a EGR1 191, 32, 106a PTEN 17-5p, 21, 20a,106a MCL1 17-5p, 32, 20a,106a STAT3 17-5p, 21, 20a,106a Table should be read in this way: APC is a target gene of miR-17-5p, miR-32, miR-20a and miR-106a and this gene is involved in colon and pancreatic cancer Another important observation from Figure 2 is that all the miRNAs except miR-155 and miR-24-2 are overexpressed in colon, pancreatic and prostate cancer. [score:9]
Target onco/tumor suppressor genes Type of cancer Colon lung pancreas prostate APC 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a EP300 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a DNMT1 17-5p, 32, 106a MSH3 17-5p, 20a, 106a RB1 17-5p, 20a, 106a HOXB4 17-5p, 20a, 106a RECK 21, 106a, 155 ETV1 17-5p, 20a,106a SYT7 17-5p, 20a,106a EGR1 191, 32, 106a PTEN 17-5p, 21, 20a,106a MCL1 17-5p, 32, 20a,106a STAT3 17-5p, 21, 20a,106a Table should be read in this way: APC is a target gene of miR-17-5p, miR-32, miR-20a and miR-106a and this gene is involved in colon and pancreatic cancerAnother important observation from Figure 2 is that all the miRNAs except miR-155 and miR-24-2 are overexpressed in colon, pancreatic and prostate cancer. [score:9]
Except miR-29b-2 (which is down regulated) and miR-32 (which is deleted), these are also overexpressed in lung cancer. [score:4]
For example, APC is involved in colon and pancreatic cancer and it is a predicted target of miR-17-5p, miR-32, miR-20a and miR-106a. [score:3]
EP300 is involved in colon and pancreatic cancer (predicted target of miR-17-5p, miR-32, miR-20a and miR-106a), and so on. [score:3]
It has been observed that miR-32, miR-29b-2, miR-21, miR-20a, miR-191, miR-17-5p, miR-106a, miR-155 and miR-24-2 all have significant dysregulation in lung, colon and pancreatic cancer cell line. [score:2]
This might suggest further experimentation with miR-29b-2 and miR-32 to either establish or correct this observation. [score:1]
[1 to 20 of 7 sentences]
10
[+] score: 25
Non-infected (Fold-change) miRNA [1] (fold change)MX1 myxovirus (influenza virus) resistance 1 [27]Z23168+11.46gga-miR-155(+3.55)gga-miR-206(−2.86)Interleukin 8 (IL8) [28]M16199+11.03gga-miR-32(+7.98)Interferon regulatory factor 7 (IRF7) [29]U20338+2.11gga-miR-142-5p(+2.84)Interleukin1receptor-like1, transcript variant1 [51]AB041738+1.65gga-miR-460 (only expressed in infected lungs)TNF receptor superfamily, member 19 [30]BX931334−1.85gga-miR-187(−4.35)Tipartite motif-containing 7.1 [52]BX934475−1.81NA [2]RAC serine/threonine-protein kinase3 (ATK3) [53]BX950472−1.65NAC-fringe 1 [54] U97157 −1.52 NANote: [1]miRNAs targeting on differentially expressed immune related genes; [2] No miRNAs targeting on the gene; +: Up-regulated with AIV infection; –: Down- regulated with AIV infection. [score:14]
Some miRNAs had only two viral targets, such as gga-mir-32 (targeting HA and NS genes) and gga-miR-30b (targeting M and NA genes). [score:7]
For example, human miR-32 represses the replication of the retrovirus primate foamy virus type 1 (PFV-1) through the down-regulation of replication-essential viral proteins encoded by open reading frame 2 (ORF2) [16]. [score:4]
[1 to 20 of 3 sentences]
11
[+] score: 23
Further, Sirt1, a target of differentially expressed miR-128-3p and miR-32-5p, also deacetylates p53, thereby inhibiting its transcriptional activity (47). [score:7]
MCL1, another anti-apoptotic member of the BCL2 family, is a target of miR-32-5p, and overexpression of miR-32 was shown to induce apoptosis (58). [score:5]
In this study, we identified MDM2 as a target of miR-32-5p, which we found to be downregulated in cells treated with HNSCC serum compared with those treated with serum from healthy donors. [score:5]
Importantly, our additional analysis of previously published studies of serum-circulating miRNA conducted in our laboratory (20)—as well as miRNA differentially regulated in cells treated with serum from HNSCC patients in this study—indicated that miR-32-5p represents the single common miRNA differentially regulated in the circulation of HNSCC patients, and also in cells treated with serum from HNSCC patients. [score:3]
This interaction is supported by studies demonstrating the ability of miR-32 to cause accumulation of the tumor suppressor p53 by facilitating degradation of MDM2 (46). [score:3]
[1 to 20 of 5 sentences]
12
[+] score: 17
A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overlap in their predicted target genes; B) miR-25 and miR-183, two miRNAs with a single nucleotide difference within their respective seed regions have only 18% overlap in their predicted target genes; C) The overlap of predicted targets for all 249 pairs of conserved miRNAs grouped by the number of mismatches in their respective seed regions. [score:7]
0115241.g001 Figure 1 A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overlap in their predicted target genes; B) miR-25 and miR-183, two miRNAs with a single nucleotide difference within their respective seed regions have only 18% overlap in their predicted target genes; C) The overlap of predicted targets for all 249 pairs of conserved miRNAs grouped by the number of mismatches in their respective seed regions. [score:7]
For example, the percent target gene overlap for miR-25 and miR-32 (both having the seed sequence: 5′AUUGCAC) predicted by miRanda-mirSVR is 81% (Fig. 1A). [score:3]
[1 to 20 of 3 sentences]
13
[+] score: 16
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-198, hsa-mir-206
Re -expression of FSTL1 completely reverses the inhibitory effects of miR-32-5p on secretion of inflammatory cytokines, indicating that inhibition of FSTL1 is a mediator of the anti-inflammatory effects [33]. [score:7]
A list of predicted miRNA -binding sites in the 3′UTR of human FSTL1 with associated clinical relevance is provided in Supplemental Table 1. Table 1 MicroRNA -binding sites in FSTL1 gene Human microRNA Binding position in 3′UTR Biological relevance miR-27a 1537Inflammation [24] miR-32-5p 142Inflammation [33] miR-206 2101; 2375Myogenesis [32] List, position, and biological processes of the verified microRNA -binding sites in the 3′UTR of FSTL1 gene In the normal healthy human epidermis, FSTL1 mRNA is expressed, but the protein is present at low to almost undetectable, levels. [score:3]
A list of predicted miRNA -binding sites in the 3′UTR of human FSTL1 with associated clinical relevance is provided in Supplemental Table 1. Table 1 MicroRNA -binding sites in FSTL1 gene Human microRNA Binding position in 3′UTR Biological relevance miR-27a 1537Inflammation [24] miR-32-5p 142Inflammation [33] miR-206 2101; 2375Myogenesis [32] List, position, and biological processes of the verified microRNA -binding sites in the 3′UTR of FSTL1 gene In the normal healthy human epidermis, FSTL1 mRNA is expressed, but the protein is present at low to almost undetectable, levels. [score:3]
During mycobacterial infection, miR-32-5p negatively regulates the inflammatory response [119] and promotes the survival of infected macrophages. [score:2]
Moreover, in silico analysis revealed multiple miRNA -binding sites in the 3′UTR of the FSTL1 mRNA of which three have been functionally analyzed (miR-206 [32], miR-32-5p [33], and miR-27a [24]) (Table  1). [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 16
MDM2 mRNA is upregulated in both GBM cell lines and samples [65], and the upregulation could be a consequence of the downregulation of miR-17-3p, miR-181b-5p, miR-25-3p or miR-32-5p, which directly target MDM2 gene expression [50, 65, 66]. [score:15]
It is worth noting that miR-25-3p and miR-32-5p are two miRNAs repressed by TP53, suggesting a feedback circuit between TP53 and MDM2 mediated by miRNAs [65]. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 14
Eight miRNAs (miR-183, miR-193a-5p, miR-222, miR-516b, miR-524-5p, miR-601, and miR-629, 99b) were upregulated and five miRNAs (miR-124, miR-32, miR-574-5p, miR-744, and miR-96) were downregulated. [score:7]
miR-184, miR-524-5p, miR-629, and miR-766 were upregulated, while miR-124, miR-222, miR-32, miR-744, and miR-765 were downregulated [28]. [score:7]
[1 to 20 of 2 sentences]
16
[+] score: 13
Moreover, the expression of miR-32 was upregulated in hepatocellular carcinoma tissues and cell lines and inversely the expression of PTEN was decreased (103). [score:8]
On the other hand, miR-32 is overexpressed in colorectal carcinoma inducing cell proliferation, migration, and invasion (102). [score:3]
MiR-32 induces cell proliferation, migration, and invasion in hepatocellular carcinoma by targeting PTEN. [score:2]
[1 to 20 of 3 sentences]
17
[+] score: 11
We used a combination of two microRNA prediction methods, TargetScan and PicTar, to search for all predicted gene targets of the 5 most highly upregulated (let-7s, miR-21, miR-23b, miR-27a and miR-30a) and downregulated (miR-29b, miR-32, miR-144, miR-197 and miR-212) microRNAs [13]. [score:11]
[1 to 20 of 1 sentences]
18
[+] score: 11
Other miRNAs from this paper: hsa-mir-93
These are AATK (apoptosis associated tyrosine kinase) and SLC27A1 (solute carrier family 27 fatty acid transporter member 1), which are targeted by miR32 and mir93 [*], and CDKAL1 (CDK5 regulatory subunit associated protein 1-like 1), which is targeted by miR32 (Figure 5(b)). [score:6]
We also identified the mRNAs for three proteins, AATK, SLC27A1, and CDKAL1, to be preferentially secreted out in exosomes from Nef -expressing cells and their targeting miRNAs (miR32 and miR93 [*]) to be retained in these cells. [score:5]
[1 to 20 of 2 sentences]
19
[+] score: 11
Two miRNAs significantly upregulated in infected horses, as identified by DESeq2 (miR-16 and miR-32), were also upregulated when expression levels were measured by qRT-PCR and normalized against relative levels of miR-103 (Fig.   6). [score:7]
Graphs show relative expression levels of miR-16 and miR-32 in infected and uninfected samples. [score:3]
Two of these candidates included miR-16 and miR-32. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 11
Noveski et al. determined that miR-23b, miR-32, miR-154 and miR-99 in MArrest and SCOS were up-regulated [42], and we found that these genes were also up-regulated in NOA. [score:7]
For the up-regulated genes, 21 genes among 717 genes (0.029%) were common among PostMA, MA and SCOS, and half of these genes were miRNA (LOC100130428, LOC100131541, MALAT1, MGC24103, miR-145, miR-199a-2, miR-21, miR-27b, miR-30e, miR-32, miR-99a, miR-LET7A2, miR-LET7C, miR-LET7G, PP12719, PWAR6, SNX2, TET2, ZEB2, ZNF189 and ZNF737). [score:4]
[1 to 20 of 2 sentences]
21
[+] score: 10
In addition, miR-32 inhibition is sufficient to elevate Bim expression and sensitize AML cells to chemotherapy -induced apoptosis [51]. [score:5]
Ectopic expression of miR-32 increased the differentiation response of AML cells to VitD3. [score:3]
Mir-32 is induced by VitD3 and negatively regulates the pro-apoptotic factor Bim [51]. [score:1]
Microarray analysis identified different miRNAs modulated during monocytic differentiation of AML cell lines, in particular miR-424, miR-32, and miR-181 [49– 51]. [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 10
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
[1 to 20 of 2 sentences]
23
[+] score: 10
For example, human miR-32 could inhibit the replication of primate foamy virus type 1 (PFV-1) (Lecellier et al., 2005), miR-122 was found to be up-regulated following severe liver damage and inflammation in chronic hepatitis C infection (Gholami et al., 2016), and mice depleted of miR-155 were significantly more susceptible to herpes simplex induced encephalitis (Bhela et al., 2014), implying that there is a regulatory role for miRNA in the inflammatory damage caused by virus infection. [score:7]
miRNA Fold change at 3 dpi Fold change at 5 dpi mmu-miR-466h-3p NS (Not significant) 14.311053 mmu-miR-346-5p NS 3.4766614 mmu-miR-877-3p NS 3.416667 mmu-miR-7a-5p NS 2.1413074 mmu-miR-5107-5p NS −2.047792 mmu-miR-3473a −2.2872427 −2.1317267 mmu-miR-150-5p NS −2.1770155 mmu-miR-3473b −3.2475147 −2.282881 mmu-miR-721 NS −2.6864858 mmu-miR-669b-5p NS −2.9408455 mmu-miR-709 NS −3.0065749 mmu-miR-669n NS −3.0094464 mmu-miR-468-3p NS −3.40051 mmu-miR-466m-5p NS −4.33538 mmu-miR-32-3p NS −4.5324426 mmu-miR-466h-5p NS −4.9673104 mmu-miR-3082-5p NS −6.01648 mmu-miR-466i-5p NS −7.6776285 mmu-miR-1187 NS −8.772696 mmu-miR-574-5p NS −9.259378 To confirm the validity of the differentially expressed miRNAs that had been identified by microarray analysis, we performed real-time PCR on all 20 of these miRNAs using the polyA tailing technique. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 10
Expression levels of: (c) miR-24 ΔC [t]; (d) miR-223 ΔC [t]; (e) miR-27b ΔC [t]; (f) miR-199a ΔC [t]; (g) miR-32 ΔC [t]; (h) miR-23a ΔC [t]; (i) miR-423 ΔC [t]; (j) miR-145 ΔC [t]. [score:3]
Among the 11 differentially expressed miRNAs (significant in ANOVA), eight differed significantly between HNF1B-MODY and at least one of the other groups (miR-32, miR-223, miR-23a, miR-199a, miR-27b, miR-24, miR-145 and miR-423; ESM Table 3). [score:3]
Only miR-32 showed higher expression in HNF1B than in HNF1A-MODY. [score:3]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 10
The target genes of miRNA-32, miRNA-34c, miRNA-135a, miRNA-18b, and miRNA-9, which were up-regulated in the follicular fluid of women with PCOS, were involved in insulin regulation and inflammation [28]. [score:7]
The expression of miRNA-32, miRNA-34c, miRNA-135a, miRNA-18b, and miRNA-9 was significantly increased in the follicular fluid of women with PCOS [28]. [score:3]
[1 to 20 of 2 sentences]
26
[+] score: 9
Thus, an intricate interplay between the cellular miR-32 expression and virus-encoded Tas protein was proposed to determine the success of PFV-1 infection of target cells. [score:5]
The first evidence that host cells might employ a miRNA in antiviral defense was provided by Lecellier et al. [208] who showed that human miR-32 restricts the accumulation of the retrovirus primate foamy virus type 1 (PFV-1) in human cells by targeting viral RNA transcripts. [score:3]
Interestingly, the PFV-1 appears to, apparently taking a page from the playbook used by plant viruses that encode VSRs, preempt this host response via the viral protein Tas that globally represses the miRNA biogenesis pathways including the synthesis of miR-32. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 9
Of significant interest are miRNAs with pro-fibrotic effect (miR-32, miR-155 and miR-15b*) exhibiting an increased expression, and miRNAs with an anti-fibrotic effect (miR-18a, miR-18*, miR-19a*, miR-19b-1*, miR-200a* and miR-335*) showing lower expression in cirrhotic livers (data not shown) [42- 44]. [score:5]
Our study is unable to discern why miR-155 and miR-32 (and other 12 miRNAs) are overexpressed in cirrhosis, but it is possible that underlying etiological factors (e. g., hepatitis C, alcohol, insulin resistance), hepatic inflammation or liver fibrosis may play a role. [score:3]
Our study points towards miR-155 and miR-32 as two potential miRNA which may a play in the pathogenesis of decreased hepatic CYP3A activity in cirrhosis. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 9
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, mmu-mir-32
For example, the Tat protein of HIV-1 and VSV infection up-regulate miR-32 and miR-146a, which directly target the protein expression of TRAF3 and TRAF6, respectively [251- 253]. [score:9]
[1 to 20 of 1 sentences]
29
[+] score: 9
To explain the positive correlation between PCNA and the two miRNAs, we hypothesized that one or many other genes could be inhibited by miR-92 and miR-32 and that these genes could be negative regulators of PCNA (Figure 3A). [score:4]
This results in a positive correlation in expression between hsa-miR-32, hsa-miR-92 and PCNA. [score:3]
To further explore this substantial family of CPC pairs, we focused on the PCNA gene (proliferating cell nuclear antigen) involved in cell replication and DNA repair because it was highly positively correlated with both hsa-miR-92 and hsa-miR-32. [score:1]
A. hsa-miR-32 and hsa-miR-92 (Figure 2B) repress RFX1 via a 3′UTR sequence. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 8
For example, the human hsa-miR-32 counteracts the accumulation of primate foamy virus type 1 (PFV-1) in human cells, targeting directly the PFV-1 genome and inhibiting its translation [6]. [score:8]
[1 to 20 of 1 sentences]
31
[+] score: 8
A global transcriptomic analysis of Mø infected with M. smegmatis, revealed among the most differentially regulated miRNAs miR-142-3p;-5p; miR-32 (upregulated) and miR-106b-5p (downregulated). [score:8]
[1 to 20 of 1 sentences]
32
[+] score: 8
Statistical analysis was made on Ct values normalized with a housekeeping gene; one-way ANOVA followed by Tukey’s HSD post hoc tests Three of the most down-regulated miRNAs in the metastatic group, revealed in tumour samples in our microarray analysis (cfa-miR-144, cfa-miR-32 and cfa-miR-374a), and hsa-miR-1246, known for its deregulation in plasma from human breast cancer patients [28], were chosen for the evaluation in plasma samples. [score:3]
Relative expression of cfa-miR-144, cfa-miR-32 cfa-miR-374a and hsa-miR-1246 in plasma samples from dogs with non-metastatic and metastatic tumours. [score:3]
P-values vary from 0.6 in cfa-miR-144, 0.89 in cfa-miR-32, to 0.27 in cfa-miR-374a in contrast to <1e [−07] in tumour samples and fold change 4.74, 3.54 and 3.24, respectively. [score:1]
However, validation of cfa-miR-144, cfa-miR-32 and cfa-miR-374a levels in blood samples did not follow changes observed in the non-metastatic and metastatic tumours. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 8
miR-32 up-regulation was also found in both malignant mesothelioma, and renal cell carcinoma [54, 55]. [score:4]
miR-32 is considered an oncomiR, and, as such, is often up-regulated in associated malignancies. [score:3]
miR-32. [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 8
Pichiorri et al. [25] have shown that miR-181-a/-b, miR-106b~25 and miR-32 are up-regulated in MGUS, MM primary cells and cell lines. [score:4]
The role of miR-32 as indirect regulator of p53 has been already described above. [score:3]
Among others, cluster members include miR-19a, -19b, and miR-32. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 7
We obtained similar results showing the up-regulation of genes (GATA2, SERPINE1, myosin VA, or ubiquitin specific peptidase 33) associated with endocytosis, vesicle -mediated transport, and signal transduction, whereas their corresponding miRNAs were down-regulated (e. g., mir-32, miR- 92a, miR-200c, miR, or miR-301b). [score:7]
[1 to 20 of 1 sentences]
36
[+] score: 7
The example of the former came from the study of retroviruses primate foamy virus (PFV) in the human embryonic kidney cell line 293T, which showed that human miR-32 inhibits PFV replication by impairing the translation of viral mRNAs bearing target sequences [58]. [score:7]
[1 to 20 of 1 sentences]
37
[+] score: 7
A striking example of this strategy is represented by the cell miR-32 that targets the open reading frame 2 of the primate foamy virus type 1, thereby inhibiting virus translation [28]. [score:7]
[1 to 20 of 1 sentences]
38
[+] score: 7
Intriguingly, miR-32, that inherits the same seed as miR-25 also targets Pcaf [52] but instead, upregulates the Wnt-reporter in our reporter assays (Fig. S4). [score:5]
On the other hand miRs like miR-32 or 367 that shares the seed with the miR-25/92 family could not repress Wnt reporter activity (Fig. S4). [score:1]
Additionally, the opposite effects of miR-25 and miR-32 on the Wnt reporter may imply an important and distinguishing role for the co-seed sequence of miR-25, which is strongly divergent between miR-25 and miR-32 (Fig. S4). [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 7
Moreover, the upregulation of miR-142-5p, miR-221, miR-30, miR-32, miR-374, miR-99a, miR-122 and miR-101 and the downregulation of miR-145, miR-195 and miR-98 observed in JEV-infected PK-15 cells in our study have been reported in the brains of mice infected with West Nile virus (WNV), another mosquito-borne flavivirus [34]. [score:7]
[1 to 20 of 1 sentences]
40
[+] score: 7
This would explain the high variability of the expression levels observed in the exposed group compared with the other two groups for bta-mir-19b, bta-mir-19b2, bta-mir-301a and bta-mir-32 that were all differentially expressed between the PP vs NN groups. [score:4]
Levels of mir-32 were lower in PP vs NN groups in the present study while previous studies on bovine and human pulmonary tuberculosis reported the overexpression of mir-32 in infected alveolar macrophages [64] and CD4+ T cells [65]. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 7
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
Likewise, from the miRNA-mRNA association, the under expressed genes LZTFL1, JAZF1, THBS2 and RPS14 were associated with microRNAs (miR-146b-5p, miR-1684a-3p, miR-460b-3p, miR-30e-5p, miR-33-5p, miR-148a-5p, miR-32-5p, miR-155 and miR-144-3p) that were down-regulated in pulmonary arteries (Figure 4). [score:6]
And in this study, we found more than one miRNA, including miR-142-5p, miR-32-5p, miR-1662, miR-155, miR-30e-5p and miR-34a-5p, that function together to target LRP1B in the pulmonary arteries of AS broilers, which was characterized by vascular cells proliferation. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 7
On the other hand, miR-32 and miR-124a both function as tumor suppressors by regulating multiple targets involved in UM development [11, 12]. [score:7]
[1 to 20 of 1 sentences]
43
[+] score: 6
miR-25, miR-32, miR-661 and miR-339–5p target MDM2 to up-regulate p53 protein levels and function [27– 30]. [score:6]
[1 to 20 of 1 sentences]
44
[+] score: 6
The anti-viral role of cellular miRNA was best established by the discovery that an endogenous miRNA, termed miR-32, could suppress the replication of primate foamy virus type-1 (PFV-1) in human cells [3]. [score:3]
During viral replication, miR-32 could bind viral mRNA, with imperfect complementarity, leading to suppression of viral protein synthesis and viral replication. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 6
org tool (Betel et al., 2008), we identified miR-377, miR-32, miR-410, miR-19b, and let-7f, as potential candidates to bind to the 3′-UTR sequence of the N-Wasp mRNA, ultimately suggesting that a group of different miRNAs might be directly controlling the expression of a single target in a concerted manner. [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
Cell type microRNA mRNA target Differentiation DPSCs miR-135 Nd MyogenicLi et al., 2015 miR-143 DPSCs miR-720 DNMT3a, NANOG OsteogenicHara et al., 2013 PDLSCs miR-21 PLAP-1 OsteogenicLi et al., 2012 miR-101 DPCs miR-424 VEGF, KDR Angiogenic (endothelial cells)Liu et al., 2014 DPSCs miR-196 HOX C8 OsteogenicGardin et al., 2016 DPSCs miR-218 RUNX2 OsteogenicGay et al., 2014 GMSCs PDLSCs DPSCs miR-816-3a WNT5A, EGRF Control of cell fateVasanthan et al., 2015 miR-7-5p DPSCs miR-32 DSPP OdontoblasticWang et al., 2011 miR-586 miR-885-5 WNT5A, WNT FAMILY MEMBER 5A; EGRF, EPIDERMAL GROWTH FACTOR RECEPTOR; DSPP, DENTIN-SIALOPHOSPHOPROTEIN; DNMT3A, DNA METHYLTRANSFERASE 3A; NANOG, NANOG HOMEOBOX; PLAP-1, PERIODONTAL LIGAMENT-ASSOCIATED PROTEIN 1; VEGF, VASCULAR ENDOTHELIAL GROWTH FACTOR; KDR, VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-2/KINASE INSERT DOMAIN RECEPTOR; and RUNX2, RUNT-RELATED TRANSCRIPTION FACTOR2. [score:3]
On the other hand, it was found that several miRNAs, including miR-32, miR-885-5, and miR-586, are differentially expressed during the odontoblast differentiation of DPCs (Figure 4B). [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 6
For example, a transcript in human foamy virus (PFV) can be used as the target site of human-encoded miR-32 [11]; hepatitis C virus (HCV) replication is regulated by miR-199a* that may serve as a novel antiviral therapy [12]; and human-encoded miRNAs can target crucial HIV-1 genes [13]. [score:6]
[1 to 20 of 1 sentences]
48
[+] score: 6
Zhang et al. (2017) showed that the induction of miR-32-5p strongly increases the survival rate of Mtb by directly targeting Follistatin-like protein 1 (FSTL1) through the TLR-4/miRNA-32-5p/FSTL1 pathway. [score:4]
TLR-4/miRNA-32-5p/FSTL1 signaling regulates mycobacterial survival and inflammatory responses in Mycobacterium tuberculosis-infected macrophages. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 6
Interestingly, miR-106-25, along with miR-32 and miR-181a/b, may target the p53 regulator p300-CBP -associated factor (PCAF), which would reduce tumour suppressor p53 levels in multiple myeloma [77]. [score:6]
[1 to 20 of 1 sentences]
50
[+] score: 6
With miRNA array -based expression analysis, several miRNAs were significantly down-regulated: the five miRNAs with the largest decreases were miR-32-5p, miR-143-3p, miR-145-5p, miR-338-3p, and miR-451a. [score:6]
[1 to 20 of 1 sentences]
51
[+] score: 5
Lecellier and colleagues have shown that in primate foamy virus type 1 (PFV-1), overexpression of cellular miRNA miR-32 could induce an antiviral response to inhibit virus replication [37]. [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 5
The strongest signal of overlap we identified was for a variant (rs3802177) within the 3′ UTR of the SLC30A8 gene, which maps to miRanda predicted target sites for six islet-expressed miRNAs (miR-363-3p, miR-25-3p, miR-32-5p, miR-92a-3p, miR-33a-5p, and miR-33b-5p) and reaches genome wide significance in T2D-association studies [11]. [score:5]
[1 to 20 of 1 sentences]
53
[+] score: 5
In S. mansoni, 112 miRNAs (including 84 novel miRNA families) have been reported in adult worms of S. mansoni (Marco et al., 2013); miR-4, miR-6, miR-9, miR-32, miR-125, miR-3, and miR-5 are expressed in adult worms only, and miR-20, miR-18, miR-22, miR-26 and bantam are expressed in schistosomula only (Simões et al., 2011). [score:5]
[1 to 20 of 1 sentences]
54
[+] score: 5
Most recently, the upregulation of microRNA32 expression by 1,25-VD was shown to control the levels of the pro-apoptotic protein BIM [66]. [score:5]
[1 to 20 of 1 sentences]
55
[+] score: 5
The discrepancy between the increased mRNA but no increase in protein levels of Bim in D2/CA-only treated AML cells can be explained by the previous observation that Bim mRNA is known to be targeted by miR32, which prevents its translation [38]. [score:5]
[1 to 20 of 1 sentences]
56
[+] score: 5
Furthermore, Lecellier et al. reported that host miR-32 effectively inhibits the accumulation of the retrovirus primate foamy virus type 1 (PFV-1) in human cells by targeting a sequence in the genome of the PFV-1 [13]. [score:5]
[1 to 20 of 1 sentences]
57
[+] score: 5
Emerging evidence has also supported that multiple miRNAs such as miR-200c [22, 23], miR-153 [24], miR-126 [25, 26], miR-19a [27], miR-32 [28], govern the cell invasion and metastasis in CRC through targeting their specific targets. [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 5
When compared to wildtype mice, transgenic mice had reduced expression of miR-32, -144, and -219, and upregulation of miR-7a, -7b, -181a-1, and -592. [score:5]
[1 to 20 of 1 sentences]
59
[+] score: 5
Figure 6(A) The percentage of specimens showing low or high miR-32 expression in relation to the expression levels of E2F3 and AXL; * p < 0.05. [score:5]
[1 to 20 of 1 sentences]
60
[+] score: 4
Cellular miRNA, miR-32 efficiently inhibits the replication of PFV-1 by hybridizing with the 3'UTR of viral mRNAs [15]. [score:3]
In another example [14], mammalian microRNA, miR-32 has been shown to restrict the accumulation of the retrovirus, primate foamy virus type-1 (PFV-1, akin to human HIV). [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 4
In addition, a group of nine miRNAs (miR-33b, miR-32, miR-92a, miR-92b, miR-92c, miR-367, miR-137, miR-137a, and miR-137b) predicted by TargetScan but not differentially expressed in our microarray analysis were also assayed (Figure  2). [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
Quantitative analysis of miR-32-5p, miR-142-5p, miR-455-3p and miR-1249-3p expression was performed with reverse transcription polymerase chain reaction (RT-PCR) using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Waltham, MA, USA) and 10 ng of total RNA. [score:3]
Thus, we shortlisted four miRNAs—miR-32-5p, miR-142-5p, miR-455-3p and miR-1249-3p. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 4
Especially, Wu et al. reported that miR-32 could enhance the growth, migration, and invasion in colorectal carcinoma cells by regulating PTEN expression [22]. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 4
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Another couple of miRNAs (miR-32-3p and miR-300-3p) was down-regulated around the time of the first spontaneous seizure (Supplementary Fig. S7C). [score:4]
[1 to 20 of 1 sentences]
65
[+] score: 3
The other miRNAs tested, miR-27, miR-32 and miR-101 did not show significant effects on luciferase expression in this assay (Fig. 2B). [score:2]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 3
Brain miRNAs analyzed at 5 days post-stroke revealed a small cohort of miRNAs (miR-15a, miR-19b, miR-32, miR-136, and miR-199a-3p) highly expressed exclusively in adult females. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Other miRNAs from this paper: hsa-mir-106a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-429
Examples are shown for annotated targets of hsa-miR-133a, has-miR-32, has-miR-429 and has-miR-106a. [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-30d, hsa-mir-196a-2, hsa-let-7g, hsa-let-7i, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-149, hsa-mir-200c, hsa-mir-425, hsa-mir-505, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-625, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-3146, hsa-mir-548v, hsa-mir-3174, hsa-mir-548w, hsa-mir-3192, hsa-mir-548x, hsa-mir-3605, hsa-mir-3662, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-664b, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In addition, we found three miRNA*s (miR-664*, miR-505* and miR-32*) that were differentially expressed between the two cell types with at least a 5x fold change. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
miR-302c* - - - - - - ND miR-32 +Over -expression of miR-32 was associated with poor outcome of human kidney cancer [53]. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
In order to analyze the expression pattern of circulating miRNA in serum with localized prostate cancer (PCa), benign prostate hyperplasia (BPH) and healthy individuals, Mahn et al. [129] investigated the expression pattern of selected oncogenic miRNAs in serum and demonstrated that a signature comprising miR-26a, miR-32, miR-195, and let-7i was able to discriminate between PCa and BPH patients. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Recently Bim mRNA has also been identified as a target of the potentially oncogenic miR-32 and miR-17-92 microRNA clusters [44], [45], [46], [47]. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
In addition, hsa-miR-582-5p [33], hsa-miR-99b [34], hsa-miR-125a [35], hsa-miR-26a [31] and hsa-miR-32* have also been shown to be affected in their respective expression in the context of M. tuberculosis infection. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
In the second scenario, host miRNAs interact with viral RNAs, thereby inhibiting virus replication, e. g., miR-32 can limit the replication of the retrovirus primate foamy virus (PFV) in cell culture through an interaction with PFV mRNAs [19]. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
Eight hsa-miRNAs underwent validation in the discovery samples by qPCR (miR-675-5p, miR-30c-1-3p, miR-483-5p, miR-542-5p, miR-142-3p, miR-223-3p, miR-32-3p, and miR-320a) according to the following criteria: available Exiqon probes, the best hits in bone array (signal intensity and significant differences between the groups), and predicted to target genes involved in bone metabolism. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
The luciferase assays revealed that miR-27b and miR-200b (Figure 4, Supplementary Figure S3), rather than miR-214, miR-32, and miR-429 (Supplementary Figure S2, P > 0.05) could significantly suppress the luciferase activity in pmirGLO-CREB1 (3′-UTR) and miRNAs co -transfected cells. [score:2]
Based on these data and the previous reports about the candidate miRNAs' function, we chose 5 cancer-related or tumor-suppressing miRNAs, including miR-214, miR-200b, miR-27b, miR-32, and miR-429, for further investigation. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 3
Interestingly, 8 out of these 10 miRNAs were modulated in the same direction in pDC, being miR-23a, miR-27b, miR-30c, miR-32, miR-100, miR-146a, and let-7e significantly down-modulated and miR-155 up-modulated. [score:2]
Of interest, the pattern of miRNAs in IFN-α DC was quite different from that observed in IL-4 DC, since these populations shared only the modulation of miR-100, miR-125b and miR-32, but in an opposite manner. [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 3
This has been suggested for the primate retrovirus PFV-1, where the cellular miR-32 was found to target PFV-1 sequences. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 2
Namely, pregnant rats fed SO and FO diets during the first 12 days of pregnancy showed significant lower expression of miR-449c-5p, miR-134–5p, miR-188, miR-32, miR130a, miR-144–3p, miR-431, miR-142–5p, miR-33, miR-340–5p, miR-301a, miR-30a, miR-106b, and miR-136–5p, as compared with OO, LO, and PO diets. [score:2]
[1 to 20 of 1 sentences]
79
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 2
The cellular miRNA, hsa-miR-32 has been shown to directly interfere with the replication of primate foamy virus in HeLa cells and to reduce viral RNA levels[6]. [score:2]
[1 to 20 of 1 sentences]
81
[+] score: 2
Six of the miRNAs identified as highly significant to tumors (HS-29, miR-135b, miR-32, miR-33, miR-542-5p and miR-96) displayed higher expression in pMMR stage IV as compared to stage II tumors (p < 0.05 and fold change > 1.5) (Figure 3C). [score:2]
[1 to 20 of 1 sentences]
82
[+] score: 2
Seven miR were selected for follow-up (supplementary table S7) including three miR that were differentially regulated in the N v TS comparison (miR-30c, miR-32, miR-203) and four from the N v TSI comparison (miR-10a, miR-147b, miR-1285, miR-1305). [score:2]
[1 to 20 of 1 sentences]
83
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, miR-32 and miR-33 were found to be restricted to the caput epididymis of the mouse, while being absent in all regions of the rat epididymis, and present in the caput, corpus, and cauda of the human epididymis (S4 Table). [score:1]
[1 to 20 of 1 sentences]
84
[+] score: 1
The top ten miRNAs with the highest absolute loadings for the second principal component (PC2) were hsa-miR-320a, hsa-miR-26b-5p, hsa-miR-421, hsa-miR-29a-3p, hsa-miR-450b-5p, hsa-miR-155-5p, hsa-miR-26a-5p, hsa-miR-30c-5p, hsa-miR-32-5p and hsa-miR-361-5p. [score:1]
[1 to 20 of 1 sentences]
85
[+] score: 1
Other miRNAs from this paper: hsa-mir-489, hsa-mir-653, bta-mir-32, bta-mir-653, bta-mir-489
Two PCGs were identified on BTA 8 at 100 Mb: transmembrane protein 245 (TEMEM245) and microRNA 32 (MIR32). [score:1]
[1 to 20 of 1 sentences]
86
[+] score: 1
For example, microRNA-32 (miR-32) serves as an antiviral molecule against primate foamy virus (PFV) in infected Hela cells [45]. [score:1]
[1 to 20 of 1 sentences]
87
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
However, exposure of male mice to stress or paternal stress increases several sperm microRNAs such as, miR-29c, miR-30a, miR-30c, miR-32, miR-193, miR-204, miR-375, miR-532-3p and miR-698 [159]. [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
Several other miRNAs, such as miR-32 (N/C = 6.24), miR-148a (N/C = 4.87) and miR-148b (N/C = 3.72) (Table 2) were also enriched in the nucleus to a similar extent as miR-29b. [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
46 (33) DAPK1, MET, RPS6KA3, SGK1, MELK, MAP3K20.0314HSA-MIR-32.46 (33) AXL, CDK6, SGK1, AATK, STK39, ZAK0.0418HSA-MIR-124.47 (19) AHR, E2F3, ELF4, ETS1, MITF, PLAGL2, SOX90.0118HSA-MIR-145.45 (19) KLF5, ETS1, MAF, PLAGL2 SOX90.02 18 HSA-MIR-32.4 5 (19) E2F3, GATA2, MITF, SOX4, HAND1 0.02* miRNAs identified using BioProfiling under stringent setting; gene function groups identified by classification tool of DAVID. [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
Furthermore, miR-133b, miR-143 and miR-32 in colorectal cancer [15- 17]. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
miRNAs may restrict viral replication, as exemplified by miR-32 in primate foamy virus type 1 infection (77). [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
Using these criteria, we were able to narrow our focus to 14 following miRNAs: hsa-miR-let7c; hsa-miR-let7e; hsa-miR-21; hsa-miR-125; hsa-miR-126; hsa-miR-146; hsa-miR-150; hsa-miR-182; hsa-miR-183; hsa-miR-193; hsa-miR-767; hsa-miR-149; hsa-miR-100; hsa-miR-32. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
MicroRNAs that were common in 3 of the 4 cell types were miR-15a, miR-19a, miR-29b, miR-32, miR-33a, and miR-101. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Our previous studies have confirmed that the miRNAs, miR-181a-5p, miR-146a-5p, miR-32, miR-34a and miR-486-5p, have important roles in the progression of NSCLC. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
The miR-32 molecule, which is able to block the replication of the primate foamy virus type 1 (PFV-1) in humans, is an example [86]. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
IL4/IFN-DCs (Setting 2) IFN-α CXCL-9, CXCL-10, CXCL-11, MxA, MxB, ISG-15, ISG-56K, STAT-1, IRF7, PKR, 2-5OAS, IFP35, BST2[102] IFN-DCs (Setting 1) IFN-α ↓ miR-23a; miR-27b; miR-30c; miR-32; miR-100; miR-146a; miR-1 25b; miR-let7e. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
miR-32 plays a pivotal role in human microglia activation following HIV infection (38). [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
miRNA Identity (%) Human and chicken miRNA sequences Accession number mir-29a 95.2 HumanUAGCACCAUUGAAAUCGGUU MIMAT0000086 ChickenUAGCACCAUUGAAAUCGGUU MIMAT0001096 mir-18a-5p 100.0 HumanUAAGGUGCAUCUAGUGCAGAUA MIMAT0000072 ChickenUAAGGUGCAUCUAGUGCAGAUA MIMAT0001113 mir-32-5p 100.0 HumanUAUUGCACAUUACUAAGUUGC MIMAT0000090 ChickenUAUUGCACAUUACUAAGUUGC MIMAT0001125 mir-223-3p 100.0 HumanUGUCAGUUUGUCAAAUACCCC MIMAT0000280 ChickenUGUCAGUUUGUCAAAUACCCC MIMAT0001140 mir-34a-5p 100.0 HumanUGGCAGUGUCUUAGCUGGUUGU MIMAT0000255 ChickenUGGCAGUGUCUUAGCUGGUUGU MIMAT0001173 mir-142-3p 100.0 HumanUGUAGUGUUUCCUACUUUAUGG MIMAT0000434 ChickenUGUAGUGUUUCCUACUUUAUGG MIMAT0001194 miR-155-5p 100.0 HumanUUAAUGCUAAUCGUGAUAGGGG MIMAT0000646 ChickenUUAAUGCUAAUCGUGAUAGGGG MIMAT0001106 [a]miRNAs are listed in ascending numerical order. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Among these, 16 precursors were found amongst the 43 conserved between human, mouse, cow and goat in our analysis (let-7 g, mir-101-2, mir-103, mir-107, mir-128-1, mir-1306, mir-140, mir-15b, mir-16b, mir-211, mir-218-1, mir-26a-1, mir-32, mir-33a, mir-455, let-7-2), so the location of these precursors appears to be highly conserved in all vertebrates. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
On contrary, four of liver-specific miRNAs reported here were reported in Kim et al. [9] as muscle (eca-miR-299, eca-miR-32, eca-miR-656) or colon-specific miRNAs (eca-miR-429). [score:1]
[1 to 20 of 1 sentences]