sort by

157 publications mentioning hsa-mir-33a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-33a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 433
Other miRNAs from this paper: hsa-let-7c, gga-mir-33-1, gga-let-7c, hsa-mir-33b, gga-mir-33-2
Up-regulated expression of PBX3 was consistently detected after inhibition of miR-33a-3p expression in Bel-7402 cells (Figure 4D). [score:10]
In tumors grown on CAM, PBX3 expression was markedly down-regulated in HepG2 cells transfected with miR-33a-3p mimics, while it was significantly increased in Bel-7402 cells transfected with the miR-33a-3p inhibitor (Figure 4E). [score:8]
MiR-33a-3p directly targets 3′-UTR of PBX3To understand the mechanisms underlying the inhibitory effects of miR-33a-3p on tumor growth and metastasis in HCC cells, we performed in silico prediction of target genes of miR-33a-3p by using miRWalk 2.0. [score:8]
As shown in Figure 2A, the expression level of miR-33a-3p increased significantly after the mimics' transfection at 24 h. Following with the increased miR-33a-3p expression, HepG2 cell proliferation (Figure 2B) and colony formation were both remarkably inhibited (Figure 2C and 2D). [score:7]
To further understand whether miR-33a-3p is associated with cell motility and invasion of HCC cells, we inhibited the expression of miR-33a-3p using a synthesized inhibitor in low metastatic Bel-7402 cells. [score:7]
The above results demonstrate that the ectopic expression of miR-33a-3p suppresses cell proliferation, spreading, migration and invasion in vitro, indicating that miR-33a-3p may play a key role in inhibiting cancer growth and metastasis of HCC cells. [score:7]
After inhibition of miR-33a-3p expression, the growth of Bel-7402 cells on CAM was significantly promoted (inhibitor 27.0 ± 3.8 mg vs. [score:7]
Rescue or inhibit PBX3 expression influence growth and metastasis in hepatocellular carcinoma cell treated with miR-33a-3p mimics or inhibitor. [score:7]
Figure 5Rescue or inhibit PBX3 expression influence growth and metastasis in hepatocellular carcinoma cell treated with miR-33a-3p mimics or inhibitor A–B. [score:7]
Figure 4miR-33a-3p targets PBX3 directly in hepatocellular carcinoma cells A. The expression levels of miR-33a-3p and PBX3 in HCC cell lines determined by qRT-PCR. [score:6]
Our study identifies PBX3 as a direct binding target of miR-33a-3p, leading to inhibition of hepatocellular tumor growth, migration and metastasis. [score:6]
Hence, the miR-33a-3p binding-site in the 3′-UTR of PBX3 is responsible for the inhibition of reporter's activity, suggesting that miR-33a-3p directly represses the expression of PBX3 gene through its 3′-UTR. [score:6]
Accordingly, the present study demonstrates that PBX3, as one of the direct targets of miR-33a-3p, is able to override the suppressive effects of miR-33a-3p on HCC growth and metastasis as well. [score:6]
From positive and negative sides, the above results suggest that miR-33a-3p suppresses HCC cell growth, migration, invasion and metastasis by directly targeting PBX3. [score:6]
These data suggest that over -expression of PBX3 rescued the inhibitory effect of miR-33a-3p on HCC development. [score:6]
Similar to miR-33a, here, our results demonstrate that the expression levels of miR-33a-3p were not only negatively associated with the metastatic phenotype in HCC cells and tissues, but also that miR-33a-3p plays a suppressor role in cell migration and metastasis of HCC. [score:5]
The patients with low miR-33a-3p expression displayed both shorter overall survival periods (P = 0.0335, Figure 1I) and tumor-free survival (P = 0.0295, Figure 1J), suggesting that low levels of miR-33a-3p expression are associated with poor survival of HCC. [score:5]
Rescue expression of PBX3 overrides the effects of miR-33a-3pTo determine if the PBX3 gene is required for the miR-33a-3p's effects on HCC cell invasion and metastasis, ectopic over -expression of PBX3 was performed in HepG2 cells transfected with either the negative control or miR-33a-3p mimics. [score:5]
The expression level of PBX3 was recovered significantly after ectopic over -expression of PBX3 in HepG2 cells, especially in those transfected with miR-33a-3p mimics (Figure 5A and 5B). [score:5]
Moreover, the metastatic cells were markedly increased after miR-33a-3p inhibition (inhibitor 7.0 ± 0.6 clones/embryo vs. [score:5]
Figure 3 A. The expression of miR-33a-3p in Bel-7402 cells treated with miR-33a-3p inhibitor. [score:5]
Over -expression of miR-33a-3p inhibits cell growth, spreading, migration and invasion in HepG2. [score:5]
The expression of PBX3 mRNA (M) and protein (N) in Bel-7402 cells concurrently transfected with miR-33a-3p inhibitor and shPBX3 lentiviruses. [score:5]
miR-33a is regarded as a tumor suppressor that targets cancer -associated genes involved in cell proliferation and cell cycle progression, such as CDK6, CCND1 [22] and Pim-1 [12]. [score:5]
The expression levels of PBX3 protein in HepG2 cells transfected with miR-33a-3p mimics (C) or Bel-7402 cells transfected with miR-33a-3p inhibitor (D). [score:5]
B. The expression of PBX3 mRNA in HepG2 cells transfected with miR-33a-3p mimics or Bel-7402 cells transfected with miR-33a-3p inhibitor. [score:5]
Ectopic expression of miR-33a-3p inhibited HepG2 cell proliferation, motility, migration and invasion. [score:5]
These data suggest that the inhibition of miR-33a-3p increases growth, motility, and invasion of HCC cells, which is in accordance with the results of miR-33a-3p over -expression. [score:5]
To understand the mechanisms underlying the inhibitory effects of miR-33a-3p on tumor growth and metastasis in HCC cells, we performed in silico prediction of target genes of miR-33a-3p by using miRWalk 2.0. [score:5]
It is possible that miR-33a-3p may reduce other invasion-related transcriptional targets of PBX3 rather than TIC-related target CACNA2D1. [score:5]
Taken together, our study showed that miR-33a-3p is a potent tumor suppressor in HCC, and provided evidence that lower expression of miR-33a-3p in HCC specimens is associated with metastasis and poor survival. [score:5]
A. The expression of miR-33a-3p in Bel-7402 cells treated with miR-33a-3p inhibitor. [score:5]
Ectopic expression of PBX3 abolished the suppressive effect of miR-33a-3p mimics on HepG2 cells growth (P < 0.001) and colony formation (P < 0.002) (Figure 5C-5E). [score:5]
In the present study, we tested one of them, CACNA2D1, a previously experimentally confirmed marker of TIC as a target of PBX3, but our data failed to display reverse regulation of CACNA2D1 by miR-33a-3p. [score:4]
The suppression effect of miR-33a-3p on growth and metastasis of HCC cells is mediated, at least in part, through direct destabilization of the mRNAs of PBX3. [score:4]
miR-33a-3p targets PBX3 directly in hepatocellular carcinoma cells. [score:4]
As shown in Figure 3A, the expression of miR-33a-3p was decreased by 58% with the miR-33a-3p inhibitor compared with the negative control (scrambled oligo). [score:4]
Together, these data support a regulatory role for miR-33a-3p and suggest that miR-33 inhibits tumor cell proliferation and metastasis by both arms of the miR-33a /miR-33a-3p duplex. [score:4]
Moreover, miR-33 [*] targets the key transcriptional regulators of lipid metabolism, including SRC1, SRC3, NFYC, and RIP140 [10]. [score:4]
Moreover, the down-regulation of miR-33a-3p related to the increased PBX3 mRNA levels in HCC patients at least partially predicts a higher metastasis potential and poor prognosis. [score:4]
These data suggest that down-regulation of miR-33a-3p correlates with the high metastatic phenotype in HCC cells. [score:4]
The down-regulation of miR-33a-3p was associated with metastases in hepatocellular carcinoma (HCC) cell lines and tumor tissues from hepatocellular carcinoma patients. [score:4]
Down-regulation of miR-33a-3p is associated with the metastatic properties of human HCC cells. [score:4]
Mutation of PBX3 was introduced in the predicted miR-33a-3p binding site by a QuikChange site-directed mutagenesis kit (Stratagene, Foster City, CA, USA). [score:3]
E. The level of PBX3 mRNA in chick embryo chorioallantoic membrane (CAM) tumor transfected with miR-33a-3p mimics or inhibitor. [score:3]
The effect of overexpression of miR-33a-3p and PBX3 on HepG2 cells proliferation (C) and colony formation (D, E). [score:3]
Relationships between the expression of miR-33a-3p mRNA and the clinicopathologic features in 85 HCC patients. [score:3]
Similarly, ectopic expression of PBX3 resulted in enhanced migration and invasion of HepG2 cells transfected with either the negative control or miR-33a-3p mimics (Figure 5F and 5G). [score:3]
Quantitative determination of human Alu expression in CAM lungs by quantitative reverse transcription PCR (qRT-PCR) showed that the intravasation of HepG2 cells was prominently abrogated by miR-33a-3p mimics (Figure 2L). [score:3]
The functional relevance of miR-33a in cancer was established in 2012, and it was shown to act as a tumor suppressor in lymphoma and colon carcinoma [12]. [score:3]
Target prediction for miR-33a-3p candidates relied on complementarity between the miRNAs and putative binding sites on transcripts. [score:3]
To choose a standard z-score to define over -expression in HCC, we calculated standardized scores (z-scores) for the expression levels of miR-33a-3p. [score:3]
It was shown that PBX3 gene was at the top of list with the smallest P value among all the predicted miR-33a-3p targets. [score:3]
The effects of over -expression of miR-33a-3p on HepG2 cell proliferation (B) and colony formation (C, D). [score:3]
Not surprisingly, the expression levels of miR-33a-3p were significantly lower in tumor tissues than in the paired adjacent tissues (P = 0.02; Figure 1B). [score:3]
The above data demonstrate that the low expression levels of miR-33a-3p in HCC tissues are correlated with higher invasion properties, low 4-year survival rate and early recurrence. [score:3]
G. The correlation between the expression level of miR-33a-3p and PBX3 mRNA in HCC samples (n = 89 cases). [score:3]
Figure 1 A. Comparison of miR-33a-3p expression levels in HCC cell lines. [score:3]
Transfection of miR-33a-3p mimic or inhibitor. [score:3]
A. The expression of miR-33a-3p after transfection of mimics into HepG2 cells. [score:3]
To determine whether PBX3 is a direct target of miR-33a-3p, a luciferase reporter assay was performed with vectors containing 3′-UTR of PBX3 including the putative binding sites of miR-33a-3p (Figure 4F). [score:3]
However, there is no data available about the functional relevance and expression profile of miR-33a-3p in HCC or other cancers. [score:3]
A. Comparison of miR-33a-3p expression levels in HCC cell lines. [score:3]
The expression levels of miR-33a-3p were determined by qRT-PCR and normalized to U6. [score:3]
Whether the miR-33a-3p targets similar genes with miR-33a in growth and metastasis of HCC is still worthy of further study. [score:3]
However, multivariate Cox proportional hazard mo del analysis failed to indicate that the expression of miR-33a-3p is an independent prognostic factor (Supplementary Table S1). [score:3]
Figure 2 A. The expression of miR-33a-3p after transfection of mimics into HepG2 cells. [score:3]
These data reveal that miR-33a-3p suppressed both tumor growth and metastasis of HCC cells. [score:3]
Members of miR-33 family are intronic miRNAs that are located within the sterol regulatory element -binding protein (SREBP) genes and function as regulators of glucose and lipid metabolism [10, 11]. [score:3]
Inhibition of miR-33a-3p enhanced cell growth, motility and invasion in Bel-7402 cells. [score:3]
To study the correlation between miR-33a-3p and PBX3, the mRNA expression levels of PBX3 were analyzed by real-time PCR in the same set of 89 primary HCC tissues. [score:3]
Inhibition of miR-33a-3p increased Bel-7402 cell proliferation, motility, migration and invasion. [score:3]
A. The expression levels of miR-33a-3p and PBX3 in HCC cell lines determined by qRT-PCR. [score:3]
Decreased expression of miR-33a-3p is associated with higher invasion properties, low 4-year survival rate, and early recurrence. [score:3]
As shown in Figure 4A, the expression level of proto-oncogene PBX3 displayed a negative correlation with miR-33a-3p in HCC cell lines. [score:3]
The PBX3 level was considerably decreased after transfection of shPBX3 even in the presence of miR-33a-3p inhibitor (Figure 5M and 5N). [score:3]
The migration and invasion of Bel-7402 cells after concurrently transfected with miR-33a-3p inhibitor and shPBX3 lentiviruses (O). [score:3]
To determine if the PBX3 gene is required for the miR-33a-3p's effects on HCC cell invasion and metastasis, ectopic over -expression of PBX3 was performed in HepG2 cells transfected with either the negative control or miR-33a-3p mimics. [score:3]
Accordingly, short hairpin PBX3 (shPBX3) genes were transfected into Bel-7402 cells concurrently with the negative control or miR-33a-3p inhibitor. [score:3]
The 3′ untranslated region (3′ UTR) of the mRNA sequence of PBX3 containing predicted miR-33a-3p binding site was amplified by PCR. [score:3]
As indicated in Figure 1A, miR-33a-3p expression is relatively lower in cells with high metastatic potential (HepG2 and HuH7 cells) than those with low metastatic ability (Bel-7402 and QGY7701). [score:3]
MiR-33a-3p was reported to have a higher expression level than miR-33a in liver tissue [10]. [score:3]
B. Expression levels of miR-33a-3p in HCC and matched adjacent nontumorous tissues. [score:3]
The effects of inhibition of miR-33a-3p on Bel-7402 cell proliferation (B) and colony formation (C, D). [score:3]
Furthermore, there were no metastatic clones formed except for few scattered cells in the chick embryo lungs were detected upon miR-33a-3p over -expression. [score:3]
The expression of PBX3 mRNA (A) and protein (B) in HepG2 cells concurrently transfected with miR-33a-3p mimics and PBX3 lentiviruses. [score:3]
Rescue expression of PBX3 overrides the effects of miR-33a-3p. [score:3]
Moreover, transfection of HepG2 cells with miR-33a-3p mimics led to a significant reduction of the PBX3 expression both at the mRNA and protein levels (Figure 4B and 4C). [score:3]
Target genes of miR-33a-3p were predicted using the algorithms of the prediction database miRWalk 2.0. [score:3]
Figure 3B–3D revealed that the inhibition of miR-33a-3p in Bel-7402 cells remarkably increased cell growth (P < 0.001) and colony formation (P = 0.018). [score:3]
Decreased level of miR-33a-3p expression predicts a short survival time. [score:3]
qRT-PCR of the human specific Alu sequence also demonstrated that the intravasated tumor cells into chick embryo lung tissues were significantly increased by miR-33a-3p inhibition (P = 0.038, Figure 3L). [score:3]
As shown in Figures 1C–1G, low miR-33a-3p expression levels were significantly associated with big tumor size (P = 0.026), venous invasion (n = 22; median value 0.0005 vs. [score:3]
Computational prediction of miR-33a-3p target genes. [score:3]
However, there was no significant correlation between miR-33a-3p expression and gender, age at surgery, or hepatic cirrhosis (Table 1). [score:3]
In a previous study, miR-33a was shown to functions as a tumor suppressor in multiple cancers, such as melanoma, breast cancer, and osteosarcoma [19– 21]. [score:3]
MiR-33a-3p directly targets 3′-UTR of PBX3. [score:3]
Furthermore, our in vivo study indicated that the inhibitory effects of miR-33a-3p on tumor growth and metastasis in the CAM mo del were also counteracted by transfection with PBX3 complementary DNA (cDNA; Figures 5H-5L). [score:3]
Research from Goedeke et al. showed that miR-33 [*] and miR-33 share the same targets involved in cholesterol efflux (ABCA1 and NPC1), fatty acid metabolism (CROT and CPT1a), and insulin signaling (IRS2) [10]. [score:3]
To determine whether miR-33a-3p was associated with metastasis in clinical samples, we detected miR-33a-3p expression in 89 paired HCC and normal tissues. [score:3]
HepG2 cells were transfected with miR-33a-3p mimic (5′-CAA UGU UUC CAC AGU GCA UCA C-3′) and Bel-7402 cells were transfected with miR-33a-3p inhibitor (5′-GUG AUG CAC UGU GGA AAC AUU G-3′) (Gene-Pharma Co. [score:3]
The wound-healing assay indicated that the spreading of miR-33a-3p over -expressing HepG2 cells was much slower than in the control cells (Figure 2E). [score:2]
MiR-33a is also regarded as a good prognostic indicator of overall survival in pancreatic cancer patients [13] and as a suppressor of bone metastasis in lung cancer [14]. [score:2]
The wound-healing assay showed that Bel-7402 cell spread was faster after miR-33a-3p inhibition (Figure 3E). [score:2]
Next, we adopted a modified chick embryo chorioallantoic membrane (CAM) assay to assess the influence of miR-33a-3p over -expression on growth and metastatic properties of HepG2 cells in vivo. [score:2]
I and J. Overall survival analysis (I) and the tumor-free survival (J) of patients were compared based on the expression levels of miR-33a-3p in HCC tumor tissues. [score:2]
The expressions of miR-33a-3p were compared between tumor size (C), venous invasion (D), TNM stage (E), survival years (F), and recurrence (G) in HCC tissues. [score:2]
Spearman's rank correlation analysis demonstrated that PBX3 mRNA levels were inversely correlated with those of miR-33a-3p (P < 0.0001, r = −0.6289, Figure 4G), confirming that miR-33a-3p is a negative regulator of PBX3 in HCC tissues. [score:2]
To investigate the functional relevance of miR-33a-3p in HCC, we first examined the expression level of miR-33a-3p in HCC cells with different metastatic properties by real-time polymerase chain reaction (PCR). [score:1]
Conventionally, the most abundant strand is defined as the mature miRNA strand (e. g., miR-33a or miR-33a-5p), whereas the less abundant strand called the miRNA star strand (e. g., miR33a [*] or miR-33a-3p). [score:1]
F. Sequence alignment of human miR-33a-3p seed sequence with 3′-UTR of PBX3 and its mutated sequence in the matched binding sites. [score:1]
The migration and invasion of HepG2 cells after concurrently transfected with miR-33a-3p mimics and PBX3 lentiviruses (F). [score:1]
MiR-33a-3p (MIMAT0004506), whose previous name is miR-33a*, shares a pre-miRNA hairpin with miR-33a (MIMAT0000091). [score:1]
In the present study, we detected the expression profile of miR-33a-3p in HCC, investigated its role in tumor growth and metastasis, and characterized its target gene. [score:1]
The computational analysis revealed that miR-33a-3p bound to the 3′-UTR of PBX3 with seed length of 12 and 13 nt. [score:1]
As shown in Figure 2H and 2I, the tumor growth of HepG2 cells on CAM was significantly decreased by 60% after the transfection of miR-33a-3p mimics (miR-33a-3p 15.8 ± 2.9 mg vs. [score:1]
The Firefly luciferase reporter constructs was created to detect luciferase activity in HEK-293FT cells transfected with miR-33a-3p mimics and wild-type or mutated 3′-UTR of PBX3. [score:1]
H. The ROC analysis for z-scores of miR-33a-3p expression to evaluate the survival status. [score:1]
We then analyzed the relationship between miR-33a-3p expression and clinicopathologic characteristics in a total of 85 cases with long-term follow-up of patients. [score:1]
[1 to 20 of 119 sentences]
2
[+] score: 417
Together with the fact that miR-33a induces the downregulation of β-catenin directly [31], or indirectly by regulating Pim-3/AKT/Gsk-3β (Figure 6E and 6F), these results reveal that the negative correlation between miR-33a expression and β-catenin expression determines gemcitabine resistance. [score:11]
Although a previous study showed that miR-33a -mediated downregulation of cyclin -dependent kinase 6 (CDK6) reduces cell proliferation [20, 24], we found that overexpression of miR-33a did not downregulate CDK6 protein in SW1990 or MiaPaca-2 cells (Figure 6A), indicating that the effects on Pim-3 expression are specific to pancreatic cancer cells that we examined. [score:11]
Moreover, stable expression of miR-33a in pancreatic cancer cells led to a significant downregulation of Pim-3 protein expression and inhibited cancer cell growth both in vitro and in vivo. [score:10]
Overexpression of miR-33a led to a marked downregulation of Pim-3 expression, thereby inhibiting AKT/Gsk-3β/β-catenin signaling, which in turn reduced cell proliferation and increased the chemosensitivity of pancreatic cancer cells to gemcitabine both in vitro and in vivo. [score:10]
To the best of our knowledge, this is the first study to (i) demonstrate that plasma miR-33a levels could be a valuable biomarker and an important prognostic factor for human pancreatic cancer; (ii) provide evidence that miR-33a synergistically increases the sensitivity of PDAC cells to gemcitabine; (iii) identify Pim-3 as a direct binding target of miR-33a; and (iv) demonstrate that miR-33a downregulates Pim-3 to inhibit tumor growth and chemoresistance, in part via the AKT/Gsk-3β/β-catenin signaling cascade, in pancreatic cancer. [score:9]
Although miRNA expression is regulated by a number of stimuli [35], the mechanism by which miR-33a expression is inhibited after gemcitabine treatment remains unknown. [score:8]
miR-33a suppresses Pim-3 expression by directly targeting its 3′UTR. [score:8]
Taken together, the results reported herein show that miR-33a is a potent tumor suppressor in the pancreas and that its growth inhibitory effects are mediated, at least in part, via downregulation of the Pim-3 proto-oncogene. [score:8]
Downregulation of Pim-3 kinase by miR-33a inhibits cell proliferation and chemosensitivity, in part by regulating the AKT/Gsk-3β/β-catenin cascade. [score:7]
In line with previous reports [29, 30], we found that the AKT/β-catenin signaling was activated in gemcitabine-resistant pancreatic cancer cells, and that overexpression of miR-33a reversed the increased expression of β-catenin by inhibiting Pim-3/AKT/β-catenin signaling (Figure 6G). [score:7]
Here, we showed that miR-33a acts as an important suppressor of human pancreatic cancer by directly regulating Pim-3 expression at the post-transcriptional level. [score:7]
Loss of miR-33a expression, leading to the induction of Pim-3 expression, appears to be a critical event in the development of gemcitabine resistance. [score:6]
Therefore, early examination of miR-33a expression in the plasma and Pim-3 expression in tissues may aid the development of new therapeutic strategies and predict the prognosis of pancreatic cancer. [score:6]
Downregulation of Pim-3 by miR-33a inhibits cell proliferation and chemoresistance, in part by activating the AKT/glycogen synthase kinase 3β/β-catenin cascade. [score:6]
Plasma miR-33a expression is positively correlated with tissue miR-33a expression and an improved prognosis for patients with pancreatic cancer. [score:5]
Figure 2Overexpression of miR-33a increases the chemosensitivity of human pancreatic cancer cells to gemcitabine both in vitro and in vivo A. The effects of stable overexpression of miR-33a on pancreatic cancer cell viability. [score:5]
In addition, stable expression of miR-33a reduced the number of proliferating Ki67 -positive cells in SW1990-res tumors, and acted synergistically with gemcitabine to inhibit this parameter (Figure 3G and 3H). [score:5]
Pim-3 expression is inversely correlated with miR-33a expression. [score:5]
Notably, plasma miR-33a levels in healthy controls were similar to those in pancreatic cancer patients with low Pim-3 expression; however, plasma miR-33a levels were significantly lower in pancreatic cancer patients with high Pim-3 expression than in controls (Figure 5E). [score:5]
Moreover, transfection of MiaPaca-2 and PCI55 pancreatic cancer cells with miR-33a mimics led to a significant reduction in the expression of Pim-3 protein, but not in Pim-3 mRNA expression (Figure 4B). [score:5]
Figure 3Overexpression of miR-33a reverses the chemoresistance of pancreatic cancer cells to gemcitabine both in vitro and in vivo A. The expression levels of miR-33a in the indicated resistant and parental cell lines, as determined by qRT-PCR. [score:5]
Pim-3 expression is negatively correlated with miR-33a expression and a poor prognosis. [score:5]
To determine whether overexpression of miR-33a reverses gemcitabine resistance, miR-33a was stably expressed in SW1990-res and Mia-2-res cells to generate SW1990-res-miR-33a and Mia-2-res-miR-33a cells, respectively. [score:5]
E. Comparison of the relative expression levels of miR-33a in plasma samples from 100 healthy controls (Normal) and 106 PDAC patients with low (n = 48) or high (n = 58) Pim-3 expression. [score:5]
Because Pim-3 mRNA and protein is barely detectable in normal hepatocytes [16], miR-33a may fail to target this kinase and inhibit cell proliferation in hepatic stellate cells, which are the primary mesenchymal cells in the liver. [score:5]
Moreover, transfection with Pim-3 cDNA also rescued cell growth (Figure 6C) and restored resistance to gemcitabine (Figure 6D), both of which were inhibited by miR-33a overexpression. [score:5]
Next, to determine whether Pim-3 is a direct target of miR-33a in pancreatic cancer, PCI55 and MiaPaca-2 cells were co -transfected with the miRNA mimics together with a luciferase reporter plasmid containing the wild-type 3′UTR of Pim-3 or the same region harboring a mutation in the miR-33a seed sequence (Δ3′UTR; Figure 4D). [score:5]
Notably, a number of miRNAs regulate Pim-1 kinase [37], and bioinformatics analyses revealed that some of these miRNAs may also bind Pim-3. Based on these analyses, miR-33a was identified and confirmed as a novel miRNA that directly binds to Pim-3. The miR-33a target sequence within the 3′UTR of Pim-3 is evolutionarily conserved, suggesting that it plays an important functional role. [score:5]
To determine whether miR-33a -mediated downregulation of Pim-3 requires AGO1, a RIP analysis was performed using an anti-AGO1 antibody or IgG (control). [score:4]
There was a significant negative correlation between xenograft size and miR-33a expression (Figure 2F; r = −0.8974, P = 0.0153), indicating that miR-33a negatively regulates tumor volume by increasing the chemosensitivity of pancreatic cancer cells to gemcitabine. [score:4]
MiR-33a directly targets the 3′UTR of Pim-3 in pancreatic cancer cell linesA previous study shows that miR-33a interact with Pim-1 in cancer cells [20]. [score:4]
After gemcitabine treatment, the tumor shrinkage ratio was most marked in mice that received xenografts of non-resistant cells stably overexpressing miR-33a (Supplementary Figure 3). [score:3]
B. Overall survival analysis based on the expression levels of miR-33a in the plasma. [score:3]
Overexpression of miR-33a failed to reduce the total amount of AKT protein. [score:3]
D. The effects of GEM on the viability of SW1990-miR-33a and Mia-2-miR-33a cells and that of their parental cells, which were transiently transfected with or without a pcDNA4-Pim-3 expression vector. [score:3]
To study the relationship between miR-33a and Pim-3 in pancreatic cancer, the expression levels of Pim-3 in tissue samples from 106 patients with PDAC were determined and graded by immunohistochemistry (Figure 5A). [score:3]
B. The effects of stable miR-33a expression on the viability of gemcitabine-resistant pancreatic cancer cells (Mia-2-res). [score:3]
MiR-33a directly targets the 3′UTR of Pim-3 in pancreatic cancer cell lines. [score:3]
Furthermore, overexpression of miR-33a in gemcitabine -treated SW1990 cells resulted in fewer tumors in these mice (Figure 2E). [score:3]
G. Correlation between miR-33a and Pim-3 protein expression in human pancreatic cancer cell lines (Pearson's r = −0.79, P > 0.05). [score:3]
F. Negative correlation between the volume of the xenograft tumors and miR-33a expression (Pearson's r = −0.8974, P = 0.0153). [score:3]
Stable expression of miR-33a in the SW1990 and MiaPaca-2 pancreatic cancer cell lines (SW1990-miR-33a and Mia-2-miR-33a) led to a significant reduction in growth (Figure 2A) and in the IC [50] value of gemcitabine for SW1990 and MiaPaca-2 cells (Table 2). [score:3]
C. Viability of SW1990 and MiaPaca-2 cells stably expressing miR-33a and that of their parental cells. [score:3]
Notably, the resistant cells expressed low levels of miR-33a (Figure 3A), and their growth rates were higher than those of the corresponding parental cell lines (Figure 3B). [score:3]
By contrast, the results presented herein indicate that the level of miR-33a expression was significantly lower in gemcitabine-resistant cells than in parental cells. [score:3]
Furthermore, we also found that the expression levels of miR-33a in seven pancreatic cancer cell lines were negatively correlated with those of Pim-3 protein (Figure 4F and 4G; Spearman's r = −0.79, P > 0.05). [score:3]
These observations provide the missing experimental evidence for the tumor-suppressive effect of miR-33a in human pancreatic cancer. [score:3]
Here, we found that miR-33a suppressed both the proliferation and growth of pancreatic cancer cells. [score:3]
Figure 1 A. Comparison of miR-33a expression levels in plasma from pancreatic cancer patients and healthy controls. [score:3]
Stable expression of miR-33a in SW1990 and MiaPaca-2 pancreatic cancer cells (SW1990-miR-33a and Mia-2-miR-33a) led to a reduction in the level of Pim-3 protein but not that of mRNA (Figure 6A). [score:3]
We observed that overexpression of miR-33a led to a significant reduction in the growth rate of the resistant cell lines (Figure 3B). [score:3]
Correlation between plasma miR-33a expression and the clinicopathological features of 106 PDAC specimens. [score:3]
Consistent with this, we found that miR-33a targeted Pim-3 to increase the chemosensitivity of pancreatic cancer cells and reverse the chemoresistance of pancreatic cancer cells to gemcitabine both in vitro and in vivo. [score:3]
The expression levels of miR-33a were determined by qRT-PCR and normalized to those of cel-miR-39. [score:3]
Similarly, overexpression of miR-33a in Mia-2-res cells reduced the tumor mass (Supplementary Figure 2). [score:3]
Overexpression of miR-33a reverses the chemoresistance of pancreatic cancer cells to gemcitabine both in vitro and in vivo. [score:3]
The data presented herein highlight the potential clinical utility of plasma miR-33a levels as a valuable biomarker that reflects the expression of miR-33a in human pancreatic cancer tissues. [score:3]
B. Western blotting of lysates from SW1990 and MiaPaca-2 cells stably expressing miR-33a and their parental cells with the indicated antibodies. [score:3]
Moreover, overexpression of miR-33a reduced the IC [50] value of gemcitabine towards the resistant cells (Table 2) and reduced cell viability in both a dose- and time -dependent manner (Figure 3C and 3D). [score:3]
Taken together, these results indicate that Pim-3 is a true target of miR-33a in pancreatic cancer cell lines. [score:3]
Similarly, a previous study showed that hepatocarcinoma cancer cells overexpressing miR-33a display reduced AKT phosphorylation, which affects insulin signaling [39]. [score:3]
Bottom panels show western blotting of lysates from SW1990 and MiaPaca-2 cells stably expressing miR-33a and the corresponding parental cells with the indicated antibodies. [score:3]
Hence, we next examined whether overexpression of miR-33a reduces β-catenin levels in SW1990 and MiaPaca-2 cells. [score:3]
Overexpression of miR-33a was inversely correlated with both the number and size of the tumors. [score:3]
Moreover, in situ hybridization detected visible and gradable expression of miR-33a in tissue samples from the 106 PDAC patients (Figure 1C). [score:3]
There was a significant negative correlation between xenograft size and miR-33a expression in mice injected with SW1990-res cells (Figure 3F; r = −0.8673, P = 0.0253). [score:3]
In addition, overexpression of miR-33a increased the sensitivity of both cell lines to gemcitabine in a dose- and time -dependent manner (Figure 2B and 2C). [score:3]
MiR-33a induces cisplatin-resistance in osteosarcoma cells by downregulating the transcription factor, TWIST [34]. [score:3]
The negative correlation between the expression levels of miR-33a and Pim-3 was significant in human pancreatic cancer tissues (Spearman's r = −0.236, P = 0.015). [score:3]
Moreover, serial sections of the tissues revealed a negative correlation between miR-33a and Pim-3 expression (Figure 5C; P > 0.05). [score:3]
Furthermore, overexpression of miR-33a in SW1990-res cells repressed tumor growth and reduced resistance to gemcitabine in vivo (Figure 3E). [score:3]
Figure 4 A. Alignment of the miR-33a target sequences within the 3′UTR of Pim-3 from different vertebrates. [score:3]
Overexpression of miR-33a increases the chemosensitivity of human pancreatic cancer cells to gemcitabine both in vitro and in vivo. [score:3]
F. Negative correlation between the volume of xenograft tumors and the miR-33a expression level (Pearson's r = −0.8673, P = 0.0253). [score:3]
C. Summary of the miR-33a and Pim-3 expression levels in 106 pancreatic ductal adenocarcinoma tissues. [score:3]
A. qRT-PCR analyses of Pim-3 mRNA and miR-33a levels (top panels) in SW1990 and MiaPaca-2 cells with or without stable expression of exogenous miR-33a. [score:3]
A. The expression levels of miR-33a in the indicated resistant and parental cell lines, as determined by qRT-PCR. [score:3]
The results of the in vitro and in vivo assays presented herein demonstrate that miR-33a downregulates the proto-oncogene encoding Pim-3 kinase. [score:3]
Figure 6 A. qRT-PCR analyses of Pim-3 mRNA and miR-33a levels (top panels) in SW1990 and MiaPaca-2 cells with or without stable expression of exogenous miR-33a. [score:3]
Thus, it is likely that miR-33a inhibits cell growth mainly by binding to Pim-3 in human pancreatic cancer cells. [score:3]
C. miR-33a expression in serial sections of human pancreatic cancer tissues, as analyzed by in situ hybridization. [score:3]
A. The effects of stable overexpression of miR-33a on pancreatic cancer cell viability. [score:3]
High Pim-3 expression correlated with a poor prognosis, and plasma miR-33a levels were negatively correlated with the levels of Pim-3 in pancreatic tumors. [score:3]
A. Alignment of the miR-33a target sequences within the 3′UTR of Pim-3 from different vertebrates. [score:3]
G. Immunoblot analysis of the indicated proteins and phospho-proteins (p-) in lysates of SW1990 and MiaPaca-2 parental cells, GEM-resistant cells, and GEM-resistant cells stably expressing miR-33a. [score:3]
F. The expression levels of miR-33a and Pim-3 protein in various human pancreatic cancer cell lines, as determined by qRT-PCR (top panel) and western blot (bottom panel) analysis, respectively. [score:3]
D. The negative correlation between the plasma miR-33a levels and tumor tissue Pim-3 expression in 106 PDAC patients (Spearman's r = −0.402, *** P > 0.001). [score:3]
In addition, immunohistochemical analyses revealed that stable expression of miR-33a acted synergistically with gemcitabine to reduce the number of proliferating Ki67 -positive cells (Figure 2G and 2H). [score:3]
D. Sequences of the wild-type and mutated (Δ) Pim-3 3′UTRs in the luciferase reporter constructs used in E. The asterisks indicate mutations in the miR-33a seed region. [score:2]
MiR-33a expression is reduced in plasma and tumor tissues from pancreatic cancer patients and is a prognostic indicator for pancreatic cancer. [score:2]
MiR-33a inhibited the Pim-3 kinase -mediated AKT/Gsk-3β/β-catenin pathway in pancreatic cancer cells. [score:2]
MiR-33a expression is associated with an improved prognosis for PDAC [19]. [score:2]
Instead of an anti-tumor effect, the major role of miR-33a in normal cells may be to regulate lipid metabolism and/or fibrosis. [score:2]
MiR-33a inhibits cell proliferation and increases the chemosensitivity of human pancreatic cancer cells to gemcitabine both in vitro and in vivo. [score:2]
Hence, the findings presented here expand the biological functions of miR-33a and improve our current understanding of the relationship between metabolism and carcinogenesis. [score:1]
Locked nucleic acid in situ hybridizationLocked nucleic acid in situ hybridization analyses of PDAC tissues were performed using a human miR-33a-specific double digoxigenin-labeled locked nucleic acid probe (Exiqon). [score:1]
By contrast, Li's group showed that miR-33a promotes the TGF-β1 -induced phosphorylation of AKT in hepatic stellate cells, which activates the cells to produce excess extracellular matrix, leading to liver fibrosis [40]. [score:1]
Since the poor prognosis for PDAC is due in part to chemoresistance [2], we next examined the relationship between miR-33a and gemcitabine resistance in vitro. [score:1]
To confirm the hypothesis that miR-33a is involved in chemoresistance of PDAC, we established stable SW1990 and MiaPaca-2 cell lines that were resistant to gemcitabine (SW1990-res and Mia-2-res); the resistance indices (RI) for these cell lines were 215 (95% CI, 195.27–234.73) and 173.1 (95% CI, 165.95–180.25), respectively (Table 2). [score:1]
B. qRT-PCR analyses of miR-33a and Pim-3 mRNA levels (top panel), and western blot analyses of Pim-3 protein levels (bottom panel) in MiaPaca-2 and PCI55 cells transfected with miR-33a (hsa-miR-33a) or with negative control (cel-miR-239b) mimics. [score:1]
Furthermore, the miR-33a levels in plasma samples from the 106 PDAC patients were negatively correlated with the levels of Pim-3 in the pancreatic tumors (Figure 5D). [score:1]
MiaPaca-2 and PCI55 cells were co -transfected with reporter construct and hsa-miR-33a or cel-miR-239b. [score:1]
PCI55 and MiaPaca-2 cells were transfected with miR-33a or negative control (cel-miR-239b) mimics (RiboBio) using Lipofectamine 2000 reagent (Life Technologies), according to the manufacturer's instructions. [score:1]
D. Size of tumors in mice that received subcutaneous implants of SW1990-miR-33a cells or parental cells. [score:1]
MiR-33a is an essential regulator of cholesterol and lipid metabolism [41]. [score:1]
By contrast, the anti-tumor effects of miR-33a might be dominant in cancer cells displaying AKT activation. [score:1]
Low plasma miR-33a levels were significantly associated with tumor size (P = 0.0381; Table 1). [score:1]
C, D. The effects of gemcitabine (GEM) on the viability of SW1990-res-miR-33a (C) and Mia-2-res-miR-33a (D) cells and their parental resistant cell lines. [score:1]
The mutant (Δ) 3′UTR of Pim-3, which contained a point-mutated sequence in the seed region of miR-33a, was generated from the wild-type Pim-3 3′UTR plasmid by overlap-extension PCR. [score:1]
Therefore, it is possible that the gemcitabine-sensitizing effect of miR-33a is a cell- or tissue-specific phenomenon. [score:1]
Also, miR-33a levels in the plasma positively correlated with miR-33a levels in the pancreatic tumors of the 106 patients (Figure 1D). [score:1]
MiR-33a reverses the chemoresistance of human pancreatic cancer cells to gemcitabine both in vitro and in vivoTo confirm the hypothesis that miR-33a is involved in chemoresistance of PDAC, we established stable SW1990 and MiaPaca-2 cell lines that were resistant to gemcitabine (SW1990-res and Mia-2-res); the resistance indices (RI) for these cell lines were 215 (95% CI, 195.27–234.73) and 173.1 (95% CI, 165.95–180.25), respectively (Table 2). [score:1]
We found that plasma miR-33a levels were higher in healthy controls than in PDAC patients (Figure 1A). [score:1]
The left flank of each mouse was inoculated subcutaneously with 2 × 10 [6] MiaPaca (Mia)-2, Mia-2-miR-33a, Mia-2-res, or Mia-2-res-miR-33a cells, or with 3 × 10 [6] SW1990, SW1990-miR-33a, SW1990-res, or SW1990-res-miR-33a cells. [score:1]
Locked nucleic acid in situ hybridization analyses of PDAC tissues were performed using a human miR-33a-specific double digoxigenin-labeled locked nucleic acid probe (Exiqon). [score:1]
Generation of Pim-3, Pim-3 short hairpin RNAs, and miR-33a stable cell lines. [score:1]
A previous study shows that miR-33a interact with Pim-1 in cancer cells [20]. [score:1]
To examine whether miR-33a bound to Pim-3, we performed in silico analyses of putative miRNA -binding sites in Pim-3 mRNA using different algorithms (www. [score:1]
org) revealed that miR-33a bound to a highly conserved sequence within the 3′UTR of Pim-3 that is conserved across different vertebrates (Figure 4A). [score:1]
C. RIP analyses of Pim-3 mRNA bound to AGO1 in MiaPaca-2 and PCI55 cells transfected with hsa-miR-33a or cel-miR-239b. [score:1]
To assess the function of miR-33a in vivo, SW1990 or SW1990-miR-33a cells were subcutaneously implanted into nude mice. [score:1]
E. Size of tumors in mice that received subcutaneous implantations of SW1990-res-miR-33a cells or parental resistant cells. [score:1]
Tumor growth in the gemcitabine -treated SW1990-miR-33a group was slower than that in the PBS -treated and gemcitabine -treated SW1990 groups (Figure 2D). [score:1]
B, C. The effects of gemcitabine (GEM) on the viability of SW1990-miR-33a (B) and Mia-2-miR-33a (C) cells and their parental cells. [score:1]
The results suggest that the plasma level of miR-33a may be a valuable biomarker and an important prognostic factor for human pancreatic cancer. [score:1]
Co-transfection of both cell lines with the miR-33a mimics repressed the luciferase activity of the wild-type Pim-3 3′UTR construct, but not that of the Pim-3 Δ3′UTR construct or empty psiCHECK-2 vector (Figure 4E). [score:1]
D. Positive correlation between the plasma and tumor tissue miR-33a levels in 106 PDAC patients (Spearman's r = 0.692, *** P < 0.001). [score:1]
Similar results were obtained using mice injected with MiaPaca-2 and Mia-2-miR-33a cells (Supplementary Figure 1A and 1B). [score:1]
Transient transfection of SW1990-miR-33a and Mia-2-miR-33a cells with Pim-3 cDNA restored the amounts of phospho-AKT, phospho-Gsk-3β, and β-catenin proteins, but did not affect the total amount of AKT protein (Figure 6B). [score:1]
The amount of Pim-3 mRNA associated with AGO1 was significantly higher in MiaPaca-2 and PCI55 pancreatic cancer cells transfected with miR-33a mimics than in parental cells or cells transfected with negative control mimics (cel-miR-239b) (Figure 4C). [score:1]
Therefore, we first examined miR-33a levels in the plasma of 106 PDAC patients and 100 healthy controls. [score:1]
A Kaplan-Meier analysis indicated that low levels of plasma miR-33a led to a significant reduction in the overall survival of 79 PDAC patients (Figure 1B). [score:1]
[1 to 20 of 132 sentences]
3
[+] score: 388
Other miRNAs from this paper: hsa-mir-185, hsa-mir-342
In silico MicroRNA target prediction and target prioritizationGene expression array results were refined using miRWalk [47], miRanda [48], RNA22 [49], and TargetScan [50] miRNA target prediction tools to prioritize the putative targets of miR-33a. [score:13]
Each miR-33a overexpression profile in VCaP and LNCaP cells was compared to corresponding non -targeting miR controls profiles by fold change using log2 expression values, then top differential genes between overexpression and control groups were selected (with minimum 1.4-fold changes comparing each overexpression profile vs. [score:10]
To identify putative miR-33a targets in PCa cells, we employed gene expression arrays to identify changes in gene expression upon miR-33a overexpression in both VCaP and LNCaP cells. [score:9]
Common downregulated genes in both LNCaP and VCaP cells upon miR-33a overexpression were ranked according to the number of algorithms that predict the tested gene as a direct target of miR-33a. [score:9]
Gene expression array results were refined using miRWalk [47], miRanda [48], RNA22 [49], and TargetScan [50] miRNA target prediction tools to prioritize the putative targets of miR-33a. [score:9]
We then analyzed the effects of miR-33a inhibition on cellular phenotypes associated with PCa progression by transfecting LNCaP and VCaP cells with non -targeting inhibitor control and synthetic miR-33a inhibitor, which effectively binds to endogenous mature miR-33a and prevent it from functioning, but not degrading it. [score:9]
In addition to PIM1, miR-33a has been also shown to directly target a variety of genes associated with cancer progression including several genes associated with cell cycle regulation such as CDK6 (cyclin -dependent kinase 6) and CCND1 (cyclin D1), which are directly targeted by miR-33a [23]. [score:8]
Overexpression of miR-33a resulted in significant downregulation of all of these genes except CDK16 and FRS2 in LNCaP cells (Figure 4B), whereas it reduced the expression of all of them in VCaP cells (Figure 4C). [score:8]
To validate whether miR-33a directly targets PIM1, we initially transfected VCaP cells with 2 different concentrations of mature miR-33a mimic or miR-33a inhibitor and analyzed the expression of PIM mRNA and protein. [score:8]
Further in silico analysis, to prioritize those potential target genes, demonstrated that 24 candidate genes were predicted to be direct targets of miR-33a by at least 3 miRNA target prediction tools (Supplementary Table 1). [score:8]
The proliferative potential of LNCaP and VCaP cells transfected with miR-33a mimic, miR-33a inhibitor or non -targeting miRNA (non -targeting miR) and LNCaP cells stably overexpressing PIM1 in the presence and absence of miR-33a mimic were measured as follows. [score:7]
Furthermore, miR-33a has been recently demonstrated to have reduced expression in lung cancer cells and to act as a bone metastasis suppressor in lung cancer through targeting parathyroid hormone related protein [17]. [score:7]
Our data show strong deregulation of PIM1 expression level upon overexpression or knockdown of miR-33a in PCa cells, which indicates involvement of miR-33a in PCa pathogenesis through altering the oncogenic PIM1 level. [score:7]
These findings indicate that miR-33a decreases proliferation and anchorage independent growth at least in part through directly targeting PIM1, however, effects on invasion are carried out through other targets. [score:6]
In theory, a single microRNA can target hundreds of mRNAs, therefore, many other targets may also contribute to phenotypes associated with miR-33a deregulation in PCa. [score:6]
Similar results were seen with the correlation between SREBF2 and HADHA, which have been shown to be downregulated in parallel to a well-known miR-33a target, HADHB [26] (Figure 7D). [score:6]
MiR-33a downregulates PIM1 through directly targeting its 3′UTR of PIM1. [score:6]
Gene expression array and bioinformatics analysis pointed to CPT1A, HADHB, YWHAH, PIM1, LDHA, EIF5A2, ABCE1, CDK16, and FRS2, as direct targets of miR-33a. [score:6]
MiR-33a inhibitor and non -targeting inhibitor control were purchased from Sigma. [score:6]
Cells transfected with miR-33a mimic, miR-33a inhibitor or non -targeting miR were suspended in a density of 3×10 [3] cells/ml in 0.3% agar diluted in RPMI and plated on a 0.6% base agar in 6-well culture plates. [score:5]
Q-RT-PCR and western blot analysis demonstrated that higher concentrations of miR-33a mimic lead to larger decreases in PIM1 expression while miR-33a inhibitor resulted in increased PIM1 (Figure 5A–5C). [score:5]
In the converse experiment, suppression of miR-33a confirmed CPT1A, HADHB, YWHAH, PIM1, LDHA, ABCE1, CDK16, and FRS2 as potential targets in at least one of the LNCaP and VCaP cells (Figure 4D, 4E). [score:5]
However, MiR-33a has been implicated as a tumor suppressor miRNA in a number of malignancies including lung cancer [17– 19], breast cancer [20], pancreatic cancer [14], osteosarcoma [21], and melanoma [22] through targeting multiple oncogenic genes [14, 22– 24], although miR-33a has not been examined in PCa. [score:5]
Co-transfecting LNCaP cells with miR-33a mimics or inhibitors together with a luciferase reporter clone containing either the wild-type PIM1 3′UTR or the same region with a mutation in the predicted seed sequence revealed that increased miR-33a repressed the luciferase activity of the wild-type PIM1 3′UTR, however, not that of the PIM1 3′UTR Mut compared to non -targeting control (Figure 5F). [score:5]
LNCaP cells were seeded in triplicates in 6-well plates at a density of 2.5 × 10 [5] cells/well and co -transfected with PIM1 3′UTR luciferase reporter (Origene, Rockville, MD, USA) and miR-33a mimic, miR-33a inhibitor or non -targeting miR using Lipofectamine 2000 reagent (Thermo Fisher Scientific). [score:5]
While these were not among our top hits as miR-33a targets in PCa, they likely contribute to the overall impact of miR-33a on PCa biology as do the targets we identified. [score:5]
After transfected with miR-33a mimic, miR-33a inhibitor or non -targeting miR, cells were seeded into invasion chambers at a density of 5 × 10 [5] cells per chamber in triplicates. [score:5]
Interestingly, we see a strong positive correlation between SREBF2 and the CPT1A, a miR-33a target (Figure 7C), rather than the negative correlation expected if miR-33a was being increased by SREBF2 expression. [score:5]
Cells were plated in 96 well plates at density of 3 × 10 [3] cells per well and after 24 hours they were transfected with miR-33a mimic, miR-33a inhibitor or non -targeting miR using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen). [score:5]
Cells were seeded in duplicates into 6 well plates and transfected with miR-33a mimic, miR-33a inhibitor or non -targeting miR. [score:5]
To find how miR-33a conducts its functional effects in PCa cells, we examined the potential direct targets of miR-33a in PCa cells via utilizing gene expression microarray analysis and bioinformatics analysis followed by Q-RT-PCR, western blot, and luciferase assay confirmation. [score:5]
To confirm that the effect of miR-33a on the activity of PIM1 in PCa is a direct effect, we also produced LNCaP cells stably overexpressing PIM1 with mutant 3′UTR (PIM1 Mut). [score:4]
Recently, several microRNAs including miR-33a have been found to directly target PIM1 in different cancer types [35, 36]. [score:4]
The decreased miR-33a not only allows upregulation of oncogenic genes such as PIM1 but also allows increased β-oxidation of fatty acids to occur. [score:4]
Taken together, these results show that PIM1 as a direct target of miR-33a in PCa cell lines. [score:4]
After confirming the gene expression array results with Q-RT-PCR, we selected PIM1 for further analysis, since its dysregulation after changes in miR-33a level was the most significant. [score:4]
Figure 1(A) Relative expression of miR-33a in tumor and normal sample pairs. [score:3]
Two biological replicates of miR-33a or non -targeting miR transfected LNCaP and VCaP cells were collected 24 hours after transfection. [score:3]
MiR-33a is downregulated in prostate tumor samples and PCa cell lines. [score:3]
Figure 4(A) The heat-map representation of differentially expressed genes in miR-33a transfected LNCaP and VCaP cells. [score:3]
To help understanding the impact of miR-33a on the activity of PIM1 in PCa, we produced LNCaP cells stably overexpressing PIM1 with a wild type 3′UTR. [score:3]
It should be noted that our in vitro experiments used over -expression or silencing which resulted in significant alterations in miR-33a levels. [score:3]
These studies have potential translational relevance in that metformin, a commonly used drug, decreases miR-33a and that decreased miR-33a has pleiotropic anticancer effects including decreasing c-MYC [44]. [score:3]
Thus, our data shows that miR-33a is a tumor suppressor in PCa. [score:3]
Mature miR-33a mimic and non -targeting mimic control were purchased from Invitrogen. [score:3]
Identification of potential miR-33a targets in PCa. [score:3]
This indicates that the functional effects of miR-33a on cellular invasion may be carried out through other targets. [score:3]
Moreover, co-transfection of miR-33a inhibitor resulted in a significant increase in the luciferase activity of the wild-type PIM1 3′UTR, although no change was detected in the mutant reporter construct activity (Figure 5G). [score:3]
However, introduction of exogenous miR-33a in both control cells and PIM1 overexpressing cells resulted in similar reduction in invasive potential (Figure 6C). [score:3]
In VCaP cells, miR-33a inhibition increased proliferation by up to 12% (modest, but statistically significant), invasion by 56% and soft agar colony formation by up to 21% (Figure 3D–3F). [score:3]
In VCaP cells, miR-33a overexpression reduced the potential of proliferation by up to 55%, invasion by 50% and soft agar colony formation by up to 57% (Figure 2D–2F). [score:3]
PIM1 expression is repressed by 3′UTR binding of miR-33a. [score:3]
The fact that decreased miR-33a in human PCa tumors is associated with more aggressive disease suggests that the losses seen are biologically significant. [score:3]
Other miR-33a targets include Twist, HIF-1α and others [17– 22, 37]. [score:3]
SREBF2 expression is not correlated with levels of miR33a. [score:3]
Relative mRNA level of PIM1 in VCaP cells transfected with either 20 pmol or 60 pmol (A) mimic miR-33a or (B) miR-33a inhibitor. [score:3]
Figure 5Relative mRNA level of PIM1 in VCaP cells transfected with either 20 pmol or 60 pmol (A) mimic miR-33a or (B) miR-33a inhibitor. [score:3]
In this report, we show that miR-33a has variable but significantly reduced expression in tumor samples in comparison to their corresponding normal prostate tissues. [score:3]
Transfection of LNCaP with miR-33a or its inhibitor resulted in decreased and increased PIM1 mRNA, respectively Figure 5D–5E. [score:3]
Relative mRNA level of PIM1 in LNCaP cells transfected with either 20 pmol or 60 pmol (D) mimic miR-33a or (E) miR-33a inhibitor. [score:3]
Strong positive correlations were seen between SREBF2 and CPT1A, HADHA and HADHB, (a known miR-33A target [26]) in metastatic lesions as well (Supplementary Figure 5A–5C). [score:3]
Our studies also suggest that PCas with decreased miR-33a, either as a property of the tumor or via metformin, will benefit from inhibition of β-oxidation using drugs as described by Schlaepfer et al. [39]. [score:3]
In this study, we show that miR-33a acts as a tumor suppressor in PCa. [score:3]
Decreased expression of miR-33a in prostate cancer. [score:3]
Furthermore, we show that miR-33a expression is decreased and is not correlated with SREBF2 mRNA levels, implying posttranscriptional mechanisms of control of miR-33a levels in PCa, leading to decreased miR33a levels. [score:3]
In LNCaP cells, miR-33a suppression increased proliferation by 30%, invasion by 75% and soft agar colony formation by up to 39% (Figure 3A–3C). [score:3]
Functional impact of miR-33a inhibition. [score:3]
Functional impact of miR-33a overexpression. [score:3]
While it is clear that miR-33a is a tumor suppressor, the biological response to this level of loss of miR33a in the human tumors is hard to judge, since the dose response to loss of miR33a in human PCa is not known. [score:3]
Taken together these studies show that miR-33a has biological functions in vitro consistent tumor suppression. [score:3]
Figure 3(A) Proliferation, (B) invasion and (C) anchorage independent growth of LNCaP cells transfected with miR-33a inhibitor. [score:3]
Overall these results indicate that in PCa SREBF2 expression does not result in increased miR-33a, unlike in many normal tissues and that additional mechanisms lead to decreased miR33a in PCa. [score:3]
Figure 6(A) Proliferation, (B) invasion and (C) anchorage independent growth of control and PIM1 overexpressing LNCaP cells transfected with miR-33a mimic. [score:3]
non-recurrent PCa samples and demonstrated that reduced miR-33a expression was significantly correlated with poor patient survival (Figure 1D). [score:3]
In silico analysis revealed a broadly conserved sequence among vertebrates between positions 734–741 of PIM1 3′UTR as a potential target for mir-33a (Supplementary Figure 2). [score:3]
A dual luciferase reporter assay was performed to confirm that PIM1 is a direct target of miR-33a in PCa cells. [score:3]
Relative luciferase activity of wild-type and mutated PIM1 3′UTR in LNCaP cells transfected with (F) mimic miR-33a or (G) miR-33a inhibitor. [score:3]
MiR-33a targets ABCA1, a cholesterol efflux protein and several mRNAs for proteins involved in β-oxidation of fatty acids including CPT1A and HADHB. [score:2]
[#] P < 0.05 when non -targeting+PIM1 is compared to miR-33a+PIM1 group. [score:2]
MiR-33a acts as tumor suppressor in PCa. [score:2]
MiR-33a, which has been shown to have an important role in the control of lipid and cholesterol metabolism [29], and has been recently implicated as tumor suppressor microRNA in various tumor types [14, 17– 22]. [score:2]
Having shown that miR-33a is decreased in PCa and acts as a tumor suppressor, we examined the levels of SREBF2 in PCa compared to benign prostate tissue. [score:2]
MiR-33a target genes. [score:2]
There is strong evidence that in normal tissues miR-33a levels are increased by increased transcription of SREBF2, resulting in coordinate regulation of cholesterol and other lipid levels by SREBF2 and miR-33a [15]. [score:2]
Comparison of miR-33a levels in PCa cell lines LNCaP, and VCaP cell lines to the immortalized benign prostate epithelial cell line PNT1a showed a significantly lower level of miR-33a level in the PCa cell lines (p < 0.05, t-test; Figure 1C). [score:1]
The decreased miR-33a levels result in increased levels of mRNAs encoding the PIM1 oncogene and genes promoting β-oxidation of fatty acids. [score:1]
We first tested the effectiveness of miR-33a mimic transfection in cells with miRNA Q-RT-PCR. [score:1]
Patient cancer samples showed an average of 1.5-fold decreases in miR-33a. [score:1]
Evaluation of miR-33a expression in all tumor and benign samples demonstrated an average of almost 1.5-fold decrease in cancer tissues (p < 0.01, t-test; Figure 1B). [score:1]
Q-RT-PCR results showed that miR-33a level in more than half of the patients' tumor samples were lower in comparison to adjacent benign prostate samples (Figure 1A). [score:1]
Further studies will be needed to determine the role of XB130 in miR-33a in PCa. [score:1]
Moreover, miR-33a reverses the impacts of PIM1 on cellular phenotypes associated with PCa progression except cellular invasion. [score:1]
Furthermore, introduction of exogenous miR-33a in LNCaP PIM1 cells significantly reduced the induction of PIM1 on proliferation to 8% and soft agar colony formation to 9% (Figure 6A, 6B). [score:1]
Since PIM1 is a well-characterized oncogene in PCa [30], we selected it for further confirmation via functional assays, which validated PIM1 as a direct target of miR-33a in PCa cells. [score:1]
In addition, decreased miR-33a activity in PCa increases the proliferative, invasive, and anchorage independent growth potential of PCa cells in vitro and increased miR33a has the opposite effect. [score:1]
However, there was no correlation of SREBF2 and miR-33a levels in the same cancer samples (Figure 7B; p >. [score:1]
MiR-33a, is a highly conserved intronic miRNA, is located within the intron 16 of sterol-response-element -binding protein gene, SREBF2, on chromosome 22 [15]. [score:1]
Lack of correlation of SREBF2 and miR33a in PCa. [score:1]
This actin filament associated protein which is phosphorylated by a number of tyrosine kinases and has been shown to decrease miR-33a [42], although the mechanism is unknown. [score:1]
To analyze the functional impact of miR-33a on PCa cells, we transfected LNCaP and VCaP cells with non -targeting miR or chemically synthesized mature miR-33a, which mimics the endogenous mature miR-33a function and evaluated the alterations in cell proliferation, invasion and soft agar colony formation. [score:1]
To explore the biological relevance of miR-33a in PCa, we initially evaluated its relative expression level in 18 pairs of PCa and matched benign tissues from radical prostatectomy specimens. [score:1]
Overall, our data indicates that in many PCas, SREBF2 is increased to drive lipid synthesis but via posttranscriptional mechanism, miR-33a is decreased. [score:1]
It is also interesting to note that ABCA1, the cholesterol efflux protein, which is decreased by miR-33a is methylated in PCa [40], which would abrogate the potential deleterious effects of increased cholesterol efflux secondary to decreased miR-33a. [score:1]
The mechanism by which miR-33a is decreased in PCa is unclear. [score:1]
Figure 2(A) Proliferation, (B) invasion and (C) anchorage independent growth of LNCaP cells transfected with miR-33a mimic. [score:1]
Our studies suggest that given the variable levels of miR-33a in PCa, those cases with higher miR-33a will most benefit from metformin treatment. [score:1]
We have also shown that there is no correlation of SREBF2 mRNA with its intronic microRNA miR-33a in PCa unlike the correlation seen in normal tissues. [score:1]
[1 to 20 of 107 sentences]
4
[+] score: 291
Other miRNAs from this paper: hsa-mir-122, hsa-mir-33b
Application Primers (5′→3′) Length of the Product (bp) ABCA1 target siteF c gagctcGCCAATTTCAGCCAAGAAGTGA 70R ccc aagcttCTTTGGGAGTAACCTATCCCCAG ABCG1 target siteF c gagctcAGGAAGAAGAAATAGAAGGGAA 267R ccc aagcttACAGAAAACCACAAAGATGAAA NPC1 target siteF c gagctcCTGGACTGCTCAACCACTGAC 211R ccc aagcttGCCTCTCCCATTGGAATGTA NPC1 target siteF AGAGACAAAAATTGCAT CAACCTGCATTTA 211 R GCAATTTTTGTCTCTATTTTTAGGGGGG CROT target siteF c gagctcATTTGCAACAGCAATGCAAG 197R ccc aagcttAGTGCTCCACTGGCAAAAAC CROT target site 1 mutationF ATCTCCCAAGTATGTTTGC GCTGTTGAGGCA 197 R GCAAACATACTTGGGAGATATGGTGTTG CROT target site 2 mutation F CCCAAGCTTAGTGCTCCACTGGCAAAAAC 197RCGAGCTCATTTGCAACAGCA GCGCAAGTAGTA HADHB target siteF c gagctcATGGGGGGACTGCTGAAGGAGT 256R ccc aagcttGAGATTAGTGTGGTTACGACGA HADHB target site 1 mutationF TGTTTTCATTAGTGC GCTGAAATGGCATTGCC 256 R GCACTAATGAAAACATACATACAGTCCT HADHB target site 2 mutationF TGCATTGAAATGGC GCTGCCAGGCACAGGA 256R TCCTGTGCCTGGCA GCGCCATTTCAATGCA ADRP target siteF c gagctcGGCTGCTGACTTGGTAGGAG 415R cg acgcgtCACAACCAGGCATTGCTCTA IRS2 target siteF c gagctcGCCCAACTCATGTCCTGTCA 358R ccc aagcttAGTTCAGTAAGGCTGGCGAC GPT2 target siteF c gagctcACAGCAGACAGGGAACACTT 223R cg acgcgtATCTGCAAGTCGAAAGCCAG AMPKα1 target siteF c gagctcAACAAAGGCGCTGAAAAAACTA 321R ccc aagcttCTGAATAAAGGGGGAAGGAACA miR-33 overexpressionF g gaattcCCTAAAGCTGGAGCCTTCCT 203R ccg ctcgagCGGCTCGCTATTTTAGTTGC miR-33 point mutation 1F GTGCATTGTAGTTGC GCTGCATGTGACGGCA 203 R GCAACTACAATGCACTACAGCTGCCACC miR-33 point mutation 2F AGTGCATTGTAGTTGCGC AACATGTGACGG 203 R GCGCAACTACAATGCACTACAGCTGCCAThe underlined lowercase letters represent the SacI and MluI enzyme loci; the lowercase letters without underlines denote base protection; and the underlined capital letters represent mutation bases. [score:37]
Luciferase activity did not differ significantly in the CROT, HADHB and NPC1 genes; this result suggests that miR-33 combines with the target genes according to a seed sequence to inhibit the expression of target genes. [score:9]
The selected target genes from this region all report either one or two target miRNA-33 binding sites, as per extended analysis of the nine-target-gene sequence in the 3′ UTR region. [score:7]
This result suggests that target Site 1 is a miR-33 target site in the HADHB gene, possibly because the two HADHB target sites are near each other. [score:7]
Previous studies indicate that the overexpression of miR-33 can reduce the oxidation of fatty acid in liver cells, whereas the inhibition of endogenous miR-33 can increase the expression of carnitine O-octanoyltransferase (CROT), CPT1A, cyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase, beta subunit (HADHB) and AMP-activated protein kinase (AMPK). [score:7]
These findings indicate that the miR-33 seed sequences and the target sites are key to inhibiting the gene expression of miR-33. [score:7]
We speculate that miR-33 does not target the inhibition of these genes, possibly because the target sequences are low in species conservatism. [score:7]
To determine the role of the miRNA-33 target site, we allow the 2–5 bases at the 5′ end to mutate; therefore, they cannot combine with the target site of the target gene. [score:7]
The NPC1 gene inhibits miR-33 in response to the mutations of NPC1 target points. [score:6]
miR-33 also regulates insulin signals considerably; therefore, its overexpression can weaken the expression of the IRS2 gene. [score:6]
Thus, the study on the regulation of miR-33 expression in geese is significant to livestock production and to the treatment of fatty liver disease in humans. [score:6]
The inhibition of endogenous miR-33 can enhance the expression of the CROT, CPT1A, HADHB and AMPK genes, as well as enhance fatty acid oxidation [7, 8]. [score:5]
Mut-miR-33 represents the mutation of miR-33, and mut-box represents the mutation of target sites. [score:5]
Figure 3Target binding sites of the miR-33 target gene. [score:5]
Thus, miRNA-33 is successfully overexpressed and can verify the target genes. [score:5]
The online software programs TargetScan, miRDB and miRCosm were used to predict the target genes of miRNA-33 with reference to the gene sequence of chickens. [score:5]
The overexpression of miR-33 can reduce the ABCA1 mRNA expression in livers and reduce the HDL levels in plasma by 25% [12]. [score:5]
After predicting the target genes of miRNA-33, we chose several important target genes, such as ABCA1, ABCG1, NPC1, CROT, HADHB, ADRP, IRS2, GPT2 and AMPKα1. [score:5]
The target genes of miR-33 were predicted using three online software programs, namely TargetScan, miRDB and miRCosm. [score:5]
The results showed that the expression level of miR-33 was significantly higher in the group transfected with the overexpression vector of miRNA-33 than in the control group transfected with the empty carrier pcDNA3.1 (Figure 4). [score:5]
Either the overexpression vector pcDNA3.1-miRNA-33 or the control vector pcDNA3.1, the report vector pMIR-REPORT of the target genes and the internal vector PhRL-TK were cotransfected into CHO cells (Figure 5). [score:5]
Studies have shown that either miRNA-33 overexpression or silence can reduce or increase the level of ABCA1 and ABCG1 mRNA expression in the liver. [score:5]
According to the instructions for the dual-luciferase reporter assay system kit (Promega, Madison, WI, USA), the luciferase -based target in vitro assay was applied to test whether miR-33 could bind to the 3′ untranslated region (UTR) of predicted target genes. [score:5]
The CROT and HADHB genes display two target points on the complementary sequence of the 3′ UTR in combination with the miR-33 seed during target gene prediction. [score:5]
Previous studies indicate that miR-33 can inhibit CROT and HADHB expression to limit the oxidation of fatty acid in the liver cells of humans and mice [22, 23]. [score:5]
The fragment containing miR-33 precursor was cloned into expression plasmid pcDNA3.1 by EcoRI and Xho I digestion to construct the miR-33 overexpression plasmid. [score:5]
As a result, the target point cannot be combined with the miR-33 seed sequence. [score:3]
The overexpression of miR-33 a/b can reduce the oxidation of fatty acid in liver cells, which can, in turn, result in the accumulation of excess triglycerides in human liver cells [7, 8]. [score:3]
Prediction of the miRNA-33 Target Gene in Landes Geese. [score:3]
Prediction of miR-33 Target Genes. [score:3]
miR-33 in the macrophage of mice can be targeted to adenosine triphosphate binding cassette transporters G1 (ABCG1) [9] and can promote excessive cholesterol output. [score:3]
Thus, we infer that they are not the target genes of miR-33. [score:3]
According to the design primers of the seed region, we constructed the pcDNA3.1-miR-33 overexpression plasmid and pMIR-REPORT-3′ UTR recombinant plasmid containing point mutation. [score:3]
The repeated experiment results indicate that in comparison with the control group, luciferase activity in the ABCA1, ABCG1, IRS2, GPT2, ADRP and AMPKα1 genes did not change significantly in the miRNA-33 overexpression group. [score:3]
Moreover, the overexpression of miR-33 can limit the oxidation of fatty acid in liver cells. [score:3]
The CROT, HADHB and NPC1 genes are the target genes of miR-33 in Landes geese. [score:3]
Hence, both sites are miR-33 target sites in the CROT gene. [score:3]
Verification of the miRNA-33 Target Site. [score:3]
Previous studies have reported that miR-33 is important in cholesterol homeostasis; thus, its overexpression limits the cholesterol excretion capability of liver cells. [score:3]
We further designed point mutation primers of the miR-33 target gene. [score:3]
Analysis of miRNA-33 Expression in the Fatty Liver of Geese. [score:3]
The expression of miR-33 in goose liver does not increase after 0 and 10 days of overfeeding (Figure 2). [score:3]
Verification of the miR-33 Target Site. [score:3]
The overexpression vectors were transfected into CHO cells and used to detect miRNA-33 levels. [score:3]
With reference to the literature, we chose a target sequence area that combines with and complements the miR-33 seed sequence area. [score:3]
Verification of the miRNA-33 Target Gene. [score:3]
In this study, we derived ABCA1, ABCG1, NPC1, CROT, HADHB, AMPKα1, IRS2, GPT2 and ADRP from the 774 target genes of miR-33 by prediction. [score:3]
Given the easy reach of points, the miR-33 seed sequence is preferably combined with target Point 1. In addition, Gerin et al. obtained results for human liver cancer cells that were consistent with those of the current study [8]. [score:3]
Expression Rule of miR-33 in Goose Fatty Liver. [score:3]
Verification of miR-33 Target Gene. [score:3]
In this study, miR-33 expression increases significantly after 19 days of overfeeding in comparison with the control group. [score:3]
The report vectors of the 2–5 base at the 5′ end of miRNA-33 and of either the 2–3 or the 5–6 base at the 3′ end of target gene are mutated. [score:3]
Additionally, we designed a pair of amplification primers of the miR-33 precursor sequence to synthesize the miR-33 overexpression vector and two pairs of mutation primers of the miR-33 mature sequence. [score:2]
These results suggest that miR-33 can not only regulate cholesterol metabolism, but also adjust the level of fatty acid and glucose metabolism. [score:2]
R000017200 10934219 6. Horie T. Ono K. Horiguchi M. Nishi H. Nakamura T. Nagao K. Kinoshita M. Kuwabara Y. Marusawa H. Iwanaga Y. MicroRNA-33 encoded by an intron of sterol regulatory element -binding protein 2 (Srebp2) regulates HDL in vivo Proc. [score:2]
miRNA-33 expression level was detected with the TaqMan microRNA assay real-time fluorescent quantitative PCR technology. [score:2]
Previous research also suggests that the miR-33 can regulate all aspects of fat metabolism by limiting the flow of cholesterol and of fatty acid degradation. [score:2]
Additionally, the results of our study will provide important information regarding the mechanism of goose hepatic steatosis through regulation of miR-33. [score:2]
In the gene intron of the sterol-regulatory element binding protein (SREBP) in fruit flies, mice, chickens, humans and other species, the highly conserved miRNA family miR-33 cooperates with these proteins to form a negative feedback loop. [score:2]
Different primer pairs (Table 1) were used in PCR reactions to amplify putative miR-33 target sites in the 3′ UTR of different genes and native or mutated miR-33. [score:2]
The concentrations of pcDNA3.1, pcDNA3.1-miR-33 and the mutation plasmid of miR-33 were diluted to 100 ng/μL. [score:2]
Marquart T. J. Allen R. M. Ory D. S. Baldán A. miR-33 links SREBP-2 induction to repression of sterol transporters Proc. [score:1]
Moreover, geese miRNA contained the complete mature miRNA-33 sequence, which is identical to that of chicken miRNA. [score:1]
Furthermore, the NPC1 3′ UTR gene in humans contains two miRNA-33 binding sites. [score:1]
Control group: pcDNA3.1 + pmiR-report + phRL-TK; miRNA-33: pcDNA3.1-miR-33 + pmiR-report + phRL-TK; mut-miR-33: pcDNA3.1-mut-miR-33 + pmiR-report + phRL-TK; mut-Box: pcDNA3.1-miR-33 + mut-pmir-report + phRL-TK. [score:1]
4.4. miRNA-33 Real-Time Reverse Transcription Polymerase Chain Reaction. [score:1]
The sequence above is the precursor sequence of miRNA-33 in Landes geese. [score:1]
Precursor Sequence of the miRNA-33 of Landes Geese. [score:1]
This finding suggests that when the sites mutate individually, another site can still be combined with the seed sequence of miRNA-33. [score:1]
In addition, part of the sequence is important to gene function as a potential miR-33 action point. [score:1]
Specifically, Rayner et al. reported that the NPC1 3′ UTR gene in humans contains two miRNA-33 binding sites. [score:1]
Rayner K. J. Sheedy F. J. Esau C. C. Hussain F. N. Temel R. E. Parathath S. van Gils J. M. Rayner A. J. Chang A. N. Suarez Y. Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis J. Clin. [score:1]
Hence, we believe that miR-33 may contribute significantly to the inducement of fatty liver in geese. [score:1]
Previous studies have detected miRNA-33a/b binding sites in the 3′ UTR of the CROT, HADHB, CPT1A and AMPKα1 genes. [score:1]
The repeated experiment results show that the luciferase activity in the CROT, HADHB and NPC1 genes did not change significantly when the seed sequence points of miRNA-33 were mutated. [score:1]
[1 to 20 of 75 sentences]
5
[+] score: 282
Among the up-regulated miRNAs in chemoresistant OS samples, miR-33a was verified to down-regulate TWIST expression, which was supported by an inverse miRNA-33a/TWIST expression trend in the validation cohort (n = 70), target-sequence-specific inhibition of TWIST-3′ untranslated region-luciferase reporter activity by miR-33a, and alteration of TWIST expression by overexpression or inhibition of miR-33a in human OS cell lines. [score:23]
With an aim to identify miRNAs regulating TWIST expression in OS, we found that miR-33a could significantly down-regulate TWIST expression, which was supported by an inverse miRNA-33a/TWIST expression trend in the validation cohort, target-sequence-specific inhibition of TWIST-3′UTR-luciferase reporter activity by miR-33a, and alteration of TWIST expression by overexpression or inhibition of miR-33a in human OS cell lines. [score:21]
By combining the microarray expression data with results of the prediction software TargetScan, three up-regulated miRNAs (miR-33a, miR-25 and miR-363) potentially able to regulate TWIST 3′-UTR were selected and individually tested for their ability to affect luciferase expression in MG-63 human OS cells co -transfected with the TWIST-3′UTR-luciferase reporter. [score:11]
In MG-63 cells, TUNEL assays were performed in normal control cells (NC), cells stably transduced with scramble control shRNA (SC), cells stably expressing TWIST-shRNA (T-shRNA), cells overexpressing miR-33a, cells transfected with antagomir-33a, cells stably expressing T-shRNA and overexpressing miR-33a, and cells stably expressing T-shRNA plus transfection of antagomir-33a. [score:10]
Saos-2 cells have a constitutive high expression of miR-33a and low expression of TWIST, while MG-63 cells have a constitutive low expression of miR-33a and high expression of TWIST. [score:9]
Figure 6 TWIST expression in osteosarcoma cells with overexpression or knockdown/inhibition of TWIST and/or miR-33a. [score:8]
In Saos-2 cells, TUNEL (terminal deoxynucleotidyl transferase mediated nick-end labeling) assays were performed in normal control cells (NC), cells stably transfected with empty pcDNA3 vector (VC), cells overexpressing TWIST, cells overexpressing miR-33a, cells transfected with antagomir-33a, cells overexpressing TWIST and miR-33a, and cells overexpressing TWIST plus transfection of antagomir-33a. [score:8]
This explains why inhibition of miR-33a by antagomir-33a had more pronounced effects on TWIST expression than overexpressing miR-33a in Saos-2 cells. [score:7]
As shown in Figure  6 B, overexpression of miR-33a decreased TWIST expression by nearly 70% in MG-63 cells, while antagomir-33a increased TWIST expression by 0.4 fold. [score:7]
The effects of overexpression and inhibition of miR-33a on TWIST expression significantly altered OS cell resistance to cisplatin, a chemotherapeutic agent routinely used in neoadjuvant chemotherapy for OS [16]. [score:7]
Our in vitro data indicate that miR-33a promotes OS cell resistance to cisplatin by down -regulating TWIST; on the other hand, inhibition of miR-33a by antagomir-33a enhances cisplatin -induced apoptosis in OS cells by up -regulating TWIST expression. [score:7]
Effect of overexpression and inhibition of miR-33a on TWIST expression in OS cells. [score:7]
Overexpression of TWIST led to an approximately two-fold increase of TWIST expression in Saos-2 cells, which was largely reversed by overexpression of miR-33a and doubled by antagomir-33a. [score:7]
The reduction of renilla luciferase activity caused by miRNA-33a was specifically abolished by the mutation of the corresponding anti-seed sequence (Figure  3 C), suggesting that miR-33a could suppress TWIST expression by acting on its predicted sequence in the 3′-UTR. [score:6]
Figure 7 Cisplatin -induced apoptosis in osteosarcoma cells with overexpression or knockdown/inhibition of TWIST and/or miR-33a. [score:6]
However, another study described the down-regulation of tumor suppressor p53 by miR-33 [26], suggesting a complex and possible context -dependent response to miR-33 manipulations. [score:6]
The effects of antagomir-33a was reversed and enhanced by knockdown and overexpression of TWIST, respectively, indicating that miR-33a promotes OS cell resistance to cisplatin by down -regulating TWIST, or antagomir-33a enhances cisplatin -induced OS cell apoptosis by up -regulating TWIST. [score:6]
Overexpression or knockdown/inhibition of TWIST and/or miR-33a did not significantly alter cell apoptosis in both Saos-2 and MG-63 cells under normal culture conditions (Figure  7 A). [score:6]
Thus, the enhancing effect of miR-33a on OS chemoresistance via down -regulating TWIST expression is a new function of this miR, and the miR-33a/TWIST signaling could be a novel mechanism involved in development of OS chemoresistance. [score:5]
As shown in Figure  6 A, inhibition of miR-33a by antagomir-33a increased TWIST expression by over 1.5 fold in Saos-2 cells. [score:5]
The apoptosis-inducing effect of TWIST overexpression was reversed by overexpression of miR-33a. [score:5]
In Saos-2 cells treated with cisplatin, inhibition of miR-33a by antagomir-33a markedly increased cell apoptosis, which was enhanced by overexpression of TWIST. [score:5]
The apoptosis-inducing effect of TWIST overexpression was reversed by overexpression of miR-33a (Figure  7 B). [score:5]
On the other hand, overexpression of miR-33a decreased TWIST expression by about 30%. [score:5]
As shown in Figure  5, miR-33a was highly expressed in Saos-2 cells, which had a low constitutive expression of TWIST at both the mRNA and the protein levels. [score:5]
In Saos-2 cells treated with cisplatin, inhibition of miR-33a by antagomir-33a markedly increased cell apoptosis, which was enhanced by overexpression of TWIST (Figure  7 B). [score:5]
A recent study indicated that miR-33a targets the proto-oncogene Pim-1 and suggested overexpression of miR-33a as an anticancer treatment [25]. [score:5]
In contrast, MG-63 cells had a constitutive low expression of miR-33a, and a high expression of TWIST at both the mRNA and the protein levels (Figure  5). [score:5]
Likewise, overexpressing miR-33a had more pronounced effects on TWIST expression than antagomir-33a treatment in MG-63 cells. [score:5]
In MG-63 cells, overexpression of miR-33a significantly decreased cisplatin -induced cell apoptosis, which was enhanced by knockdown of TWIST. [score:4]
We have demonstrated in this study that miR-33a is up-regulated in chemoresistant OS and that the miR-33a level is negatively correlated with the TWIST protein level in OS. [score:4]
Figure 3 Regulation of TWIST 3′-untranslated region (UTR) by miR-33a. [score:4]
To demonstrate a direct interaction between miR-33a and TWIST, the potential binding sequence for the miRNA within the 3′-UTR of TWIST, as predicted by TargetScan, was mutated to generate a TWIST-mut33-luciferase reporter (Figure  3 B). [score:4]
In MG-63 cells, overexpression of miR-33a significantly decreased cisplatin -induced cell apoptosis, which was enhanced by knockdown of TWIST (Figure  7 C). [score:4]
In conclusion, we demonstrate that miR-33a is up-regulated in chemoresistant OS and that the miR-33a level is negatively correlated with the TWIST protein level and the tumor necrosis rate in OS. [score:4]
Functional role of miR-33a in TWIST -inhibited OS cell survival against cisplatin. [score:3]
We next examined the effects of miRNA-33a on TWIST expression in human OS cells. [score:3]
The miR-33a expression level and the relative TWIST mRNA level and protein blot density in MG-63 cells were designated as 1, respectively. [score:3]
The findings suggest that inhibition of miR-33a/TWIST signaling could be a potential new strategy to enhance neoadjuvant chemotherapy for OS. [score:3]
In the presence of cisplatin, antagomir-33a significantly enhanced cisplatin -induced apoptosis in both Saos-2 and MG-63 cells, suggesting that inhibition of miR-33a could be a potential new strategy to enhance neoadjuvant chemotherapy for OS. [score:3]
Among the selected miRNAs, miR-33a, miR-25 and miR-363 were differentially expressed between chemoresistant and control osteosarcoma tissues based on results of the microarray analysis. [score:3]
We provide the first evidence suggesting that miR-33a promotes OS chemoresistance by down -regulating TWIST. [score:2]
miR-33a has been shown to regulate genes involved in fatty acid metabolism and insulin signaling [24]. [score:2]
The relative luciferase activity in cells co -transfected with hTR was designated as 1. (B) Schematic presentation of generation of a TWIST-mut33-luciferase reporter (mut33) by site-directed mutagenesis of the predicted binding sequence of miR-33a in TWIST 3′-UTR. [score:2]
As p53 is often mutated in OS [27], it is unlikely that miR-33a promotes OS chemoresistance through down -regulating p53 -induced apoptosis. [score:2]
Figure 4 miR-33a and TWIST levels in osteosarcoma (OS) tissues from chemoresistant and control OS patients in the validation cohort. [score:1]
To confirm the findings, we determined miRNA-33a and TWIST protein levels in chemoresistant OS patients (n = 35) and control patients (n = 35) in the validation cohort. [score:1]
TaqMan microRNA assays (Applied Biosystems) that include RT primers and TaqMan probes were used to quantify the expression of mature miRNA-33a. [score:1]
Figure 5 miR-33a and TWIST levels in osteosarcoma (OS) cells. [score:1]
Real-time RT-PCR and were performed to determine (A) miR-33a and (B) TWIST mRNA and (C) TWIST protein levels in Saos-2 and MG-63 human OS cells. [score:1]
The mean miR-33a and TWIST protein levels are marked by a horizontal bar in each group. [score:1]
In this study, we only examined the effect of miR-33a/TWIST signaling on OS cell resistance to cisplatin. [score:1]
In (B) MG-63 cells, [a] p < 0.05 vs NC and SC; [b] p < 0.05 vs T-shRNA; [c] p < 0.05 vs miR-33a; [d] p < 0.05 vs antagomir-33a; [e] p < 0.05 vs T-shRNA + miR-33a. [score:1]
MG-63 cells were co -transfected with miR-33a or miR-Vec control together with either TWIST-3′UTR-luciferase reporter or TWIST-mut33-luciferase reporter. [score:1]
In (A) Saos-2 cells, [a] p < 0.05 vs NC and VC; [b] p < 0.05 vs TWIST; [c] p < 0.05 vs miR-33a; [d] p < 0.05 vs antagomir-33a. [score:1]
Correlation analyses in the entire validation cohort (n = 70) showed that the miR-33a level was negatively correlated with the TWIST protein level in the OS tissue (r = -0.627, p < 0.001). [score:1]
The miR-33a was negatively correlated with the tumor necrosis rate (r = -0.352, p < 0.001), while the TWIST protein level was positively correlated with the tumor necrosis rate (r = 0.562, p < 0.001). [score:1]
As shown in Figure  4 A, the chemoresistant OS group presented a significantly higher range of miR-33a levels than the control group (0.32 ± 0.08 vs 0.13 ± 0.05; p < 0.001). [score:1]
Real-time RT-PCR and were performed to determine (A) miR-33a and (B) TWIST protein levels in OS tissues from the chemoresistant OS and control groups in the validation cohort (n = 35 each group), respectively. [score:1]
It is unclear whether miR-33a/TWIST would impact OS cell resistance to other types of chemotherapy agents. [score:1]
[1 to 20 of 60 sentences]
6
[+] score: 269
Six of the predicted target miRNAs were overexpressed in cells, and a translational down-regulation of β-catenin levels by miR-33a and miR-340 was observed. [score:10]
Mo del of AFB [1] action: Down-regulation of β-catenin by up-regulation of miR-33aAll these results showed that the expression of β-catenin decreased when the levels of miR-33a increased after AFB [1] exposure. [score:9]
These results suggested that miR-33a could suppress β-catenin expression at both post-transcriptional and translational levels, and miR-33a-5p was the final product of pri-miR-33a which could negatively regulate β-catenin. [score:8]
miR-33a-5p levels negatively correlate to levels of β-catenin in hepatoma carcinoma cells when exposed to AFB [1] We previously showed that AFB [1] down-regulated β-catenin expression (Figure 1C and 1D), and β-catenin was thought to be the target of miR-33a. [score:8]
Considering that GSK-3β generally mediates phosphorylation and subsequent degradation of β-catenin, the expression level of GSK-3β was examined to exclude the possibility that it might be involved in the down-regulation of β-catenin after miR-33a overexpression. [score:8]
We previously showed that AFB [1] down-regulated β-catenin expression (Figure 1C and 1D), and β-catenin was thought to be the target of miR-33a. [score:8]
It was been reported that miR-33 could inhibit cell apoptosis and control hematopoietic stem cells (HSC) self-renewal by targeting p53 [47, 48], and that this function of miR-33 could be applied to the prevention and treatment of hematopoietic disease. [score:7]
Mo del of AFB [1] action: Down-regulation of β-catenin by up-regulation of miR-33a. [score:7]
Recently, miR-33 was shown to regulate cell proliferation and cell cycle by inhibiting the expression of the cyclin -dependent kinase 6 (CDK6) and cyclin D1 (CCND1). [score:6]
Expression of miR-33a-5p is up-regulated in hepatoma carcinoma cells after exposure to aflatoxin B [1]. [score:6]
0073004.g007 Figure 7Expression of miR-33a-5p is up-regulated in hepatoma carcinoma cells after exposure to aflatoxin B [1]. [score:6]
Together with the fact that AFB [1] induced down-regulation of β-catenin (Figure 1C and 1D), these results revealed that the expression of miR-33a negatively correlated to the levels of β-catenin in cells which were exposed to AFB [1]. [score:6]
In addition, the expression of β-catenin was also down-regulated by miR-33a treatment in HepG2 cells (Figure 2C and 2D). [score:6]
In both two liver cell lines, over -expression of miR-33a reduced β-catenin expression at the post-transcriptional level (Figure 3B), consistent with the result of the western blot (Figure 2). [score:5]
As shown in Figure 4A and 4B, miR-33a-5p significantly reduced the expression of β-catenin, whereas transfection of miR-33a-3p didn’t show any suppression of β-catenin. [score:5]
mRNA expression patterns of the related genes in β-catenin signaling pathway were analyzed in Chang liver (C) and HepG2 (D) cells with miR-33a overexpression. [score:5]
The expression of miR-33a was verified after overexpression (Figure 3A), which confirmed the successful transfection of miR-33a. [score:5]
By down -regulating of β-catenin, miR-33a negatively regulated the downstream genes (C-myc and cyclin D1) of β-catenin in Wnt/β-catenin pathway, and also inhibited cells growth upon exposure to AFB [1]. [score:5]
For this purpose, the mRNA levels of β-catenin and its downstream target genes were examined by qRT-PCR after transfection of miR-33a over -expression vectors. [score:5]
While we detected the mRNA levels of β-catenin and C-myc in Chang liver cells, the degree of β-catenin translation repression may be more than its mRNA degradation, or maybe the translation repression of β-catenin by miR-33a could have occurred before β-catenin mRNA degradation. [score:5]
AFB [1] negatively regulated β-catenin by overexpression of miR-33a, and then participated in the regulation of the β-catenin signaling pathway and cell growth. [score:5]
This leads to the conclusion that GSK-3β does not take part in the down-regulation of β-catenin mediated by miR-33a. [score:4]
To further examine exact mature form of miR-33a causing the down-regulation of β-catenin, two mature miR-33a (miR-33a-5p and miR-33a-3p) mimics were synthesized, and transfected into Chang liver and HepG2 cells. [score:4]
The mature form of miR-33a, miR-33a-5p downregulates the β-catenin gene. [score:4]
In fact, miR-340 was also observed to be involved in the down-regulation of β-catenin in our research, so we believe that miR-33 and miR-340 may play their functions in a synergistic manner on the pathogenicity and carcinogenicity related to AFB [1]. [score:4]
identified that miR-33a controlled β-catenin expression by directly binding to the 3’-UTR. [score:4]
miR-33a-5p is the mature form which down-regulates the β-catenin gene. [score:4]
Meanwhile, it was determined that a down-regulation of β-catenin in cells treated with AFB [1] was accompanied with the increase of miR-33a levels. [score:4]
The results indicated that the levels of miR-33a were up-regulated in both cell lines after AFB [1] treatment (Figure 7). [score:4]
In this study, AFB [1] exposure caused the up-regulation of miR-33a and reduction of β-catenin. [score:4]
Furthermore, qRT-PCR results showed that miR-33a also down-regulated β-catenin at a post-transcriptional level. [score:4]
These results indicated that miR-33a could induce post-transcriptional down-regulation of β-catenin. [score:4]
Via the regulation of miR-33a, AFB [1] negatively regulated the levels of β-catenin, which is classified as an oncogene. [score:3]
To illustrate this clearly, Chang liver and HepG2 cells were transfected with miR-33a expression vector. [score:3]
miR-33a inhibits HCC cell growth. [score:3]
Cells were exposed to AFB [1] at their IC [50] values, and expression of miR-33a-5p were anaylzed in 48 h. Same concentration of DMSO was included as control. [score:3]
All these results showed that the expression of β-catenin decreased when the levels of miR-33a increased after AFB [1] exposure. [score:3]
miR-33a directly regulates β-catenin negatively by binding to its 3’-UTR. [score:3]
Overexpression of miR-33a decreases protein levels of β-catenin. [score:3]
It was also found that miR-33a inhibited hepatoma cell colony formation and viability. [score:3]
miR-33a directly and negatively regulates β-catenin by binding to its 3’-UTR. [score:3]
Cell proliferation rates of Chang liver and HepG2 transfected with the miR-33 over -expression construct were significantly decreased in 96 h (Figure 5A and 5B), in comparison to cells transfected with empty vector. [score:3]
Thus, to further test whether AFB [1] could induce abnormal expression of miR-33a in Chang liver and HepG2 cells, we treated both cell lines with AFB [1] at their IC [50] values, and performed qRT-PCR to detect miR-33a. [score:3]
All these results indicate that miR-33a can inhibit HCC cell proliferation. [score:3]
Since we observed that over -expression of miR-33a could repress protein levels of β-catenin, we decided to examine if miR-33a played a similar role at a post-transcriptional level. [score:3]
These results demonstrated that the miR-33a-5p could directly regulate β-catenin negatively through its binding to the site 1 in the 3’ UTR of β-catenin. [score:3]
The cell viability of Chang liver (A) and HepG2 (B) transfected with miR-33a expression vector is determined by MTT assay. [score:2]
Alternatively, perhaps C-myc reduction is caused by miR-33a directly or by the other pathways affected by miR-33a. [score:2]
Together, these results indicated that miR-33a mediated the toxicity of AFB [1] by negatively regulating β-catenin activities and functions. [score:2]
Based on the above evidence, we focused on whether miR-33a represses β-catenin by binding to the 3’-UTR of β-catenin mRNA directly. [score:2]
These findings may offer an increased understanding of miR-33a regulation, and provide novel clues for the role of miRNAs in the mechanism of carcinogenesis induced by AFB [1] and ways for prevention of HCC. [score:2]
miR-33a, belonging to the miR-33 family, regulates receptor-interacting protein 140 (RIP140) in inflammatory cytokine production, by reducing RIP140 coactivator activity for NF-κB, and hence decreasing NF-κB reporter activity and thus the inflammatory potential in macrophages [49]. [score:2]
Since β-catenin is an important component of the Wnt/β-catenin signaling pathway, negative regulation at the protein level by miR-33a must affect the Wnt/β-catenin signaling pathway and HCC cell growth as well. [score:2]
miR-33a negatively regulates β-catenin levels in cells. [score:2]
0073004.g005 Figure 5. The cell viability of Chang liver (A) and HepG2 (B) transfected with miR-33a expression vector is determined by MTT assay. [score:2]
It also disclosed a novel mode of AFB [1] toxicity to cells mediated by miRNA and shed light on the function of miR-33a in the regulation of cell proliferation and cancer generation. [score:2]
Additionally, compared with cells transfected with an empty vector, colony numbers of cells transfected with miR-33a expression construct decreased significantly (Figure 5C and 5D). [score:2]
These results clearly indicated that miR-33a could negatively regulate β-catenin at protein levels. [score:2]
miR-33a was demonstrated to negatively regulate β-catenin on both post-transcriptional and protein levels. [score:2]
Since the effect of miR-340 in Chang liver was not consistent in this study, miR-33a was chosen for further studies. [score:1]
Table S2miR-33a-5p and miR-33a-3p are synthezied according to miRBase (http://www. [score:1]
Two putative miR-33 binding sites in the 3’-UTR of β-catenin were predicted by PicTar (Figure 6A). [score:1]
miR-33a decreases the post-transcriptional activity of β-catenin and related genes in the β-catenin signaling pathway. [score:1]
0073004.g006 Figure 6 (A) Two putative binding sites of miR-33a-5p in the 3’-UTR of human β-catenin predicted by PicTar. [score:1]
miR-33a-5p levels negatively correlate to levels of β-catenin in hepatoma carcinoma cells when exposed to AFB [1]. [score:1]
miR-33a decreases the mRNA levels of β-catenin and relative genes of β-catenin signaling pathway. [score:1]
To validate the putative miR-33a-5p binding sites in the 3’ UTR of β-catenin, a luciferase reporter system was employed. [score:1]
miR-33a mimics (50 nM) or negative control were cotransfected with pMIR-luciferase reporter vectors (100 ng/mL, wild-types or mutants) and pRL-TK vectors (5 ng/mL, as a normalization for transfection efficiency) into 293T cells in 96-well plates by using Lipofectamine 2000. [score:1]
After transfection of pSilence 4.1-miR-33a or pSilence 4.1 vector (NC) into Chang liver and HepG2 cells for 48 h, cells were collected for the extraction of total RNA for real-time PCR. [score:1]
Cell 293T was co -transfected with miR-33a-5p mimics and the constructs. [score:1]
0073004.g004 Figure 4 (A) β-catenin protein levels in 48 h after miR-33a-5p and miR-33a-3p mimics transfection in Chang liver and HepG2 cells. [score:1]
miR-320a, miR-33a, miR-139, miR-340, miR-214 and miR-125a were predicted to be the better candidates based on the number of binding sites and the frequencies of prediction by three computational algorithms (Table S1). [score:1]
Similar results were also observed for the post- transcriptional activity of β-catenin in Chang liver and HepG2 after miR-33a-5p mimics transfection (Figure 4C). [score:1]
They were co -transfected into 293T cells with pRL-TK vectors and miR-33a-5p mimics (50 nM). [score:1]
The negative correlation between miR-33a and β-catenin during exposure to AFB [1] established the relationship between AFB [1] and β-catenin mediated by miR-33a. [score:1]
Result showed that both miR-33a and miR-340 decreased β-catenin protein levels in all three cell lines by 2- to 5-fold (Figure 2A and 2B). [score:1]
As β-catenin is a necessary component in the Wnt/β-catenin signaling pathway, miR-33a appeared to be a bridge between AFB [1] and the Wnt/β-catenin signaling pathway. [score:1]
Cells were transfected with miR-33a-5p mimics, and mRNA levels of the β-catenin were anaylzed in 48 h. The β-catenin mRNA levels were normalized relative to β2-MG. [score:1]
0073004.g003 Figure 3 After transfection of pSilence 4.1-miR-33a or pSilence 4.1 vector (NC) into Chang liver and HepG2 cells for 48 h, cells were collected for the extraction of total RNA for real-time PCR. [score:1]
Figure 6C showed that the luciferase activity decreased greatly (about 2-fold) for the vector containing wild-type β-catenin 3’-UTR co -transfected with miR-33a-5p. [score:1]
In summary, we preliminarily established the relationship between miR-33a and AFB [1] in liver cells. [score:1]
[1 to 20 of 81 sentences]
7
[+] score: 261
Other miRNAs from this paper: mmu-mir-33, hsa-mir-33b
Interestingly, the expression of ABCA1, a very well-established miR-33 target gene, only increased significantly at the protein level (Fig 2G), suggesting that this gene is likely regulated at the translational level by miR-33. [score:8]
Taken together, these results suggest that the increased expression of SREBP-responsive genes in mice treated with miR-33 ASO is not due to a direct effect of miR-33 on SREBP1 but rather to its inhibitory action on NFYC, which is a SREBP co-activator. [score:6]
Moreover, the expression of HMGCR, the rate-limiting enzyme of cholesterol biosynthesis, and the LDLR were also upregulated when we silenced miR-33 in mice (Fig 2G). [score:6]
Surprisingly, we found that miR-33 fails to repress the 3′UTR activity of both genes, suggesting that miR-33 does not regulate their expression directly (Supplementary Fig S1C and D). [score:5]
Together, these results demonstrate that long-term anti-miR-33 therapy in mice fed a HFD results in a derepression of numerous miR-33 target genes involved in cholesterol export and fatty acid oxidation but causes a significant increase in the expression of genes associated with cholesterol and fatty acid synthesis, thus leading to moderate hepatic steatosis. [score:5]
Mechanistically, we found that miR-33 inhibition raises NFYC expression. [score:5]
As expected, anti-miR-33 therapy significantly increased the mRNA expression of previously identified miR-33 target genes, including receptor-interacting protein 140 (RIP140), CROT, CPT1A, HADHB, nuclear co-activator 3 (SRC3), AMPK, and SRC1 (Fig 2F–J). [score:5]
To investigate whether miR-33 directly regulates genes involved in fatty acid and cholesterol metabolism, we used a combination of bioinformatic approaches (targetscan, pictar, and mirwalk) to identify potential novel targets of miR-33. [score:5]
This finding could explain why sustained derepression of miR-33 in vivo increases hepatic NFYC levels leading to increased expression of SREBP-regulated genes, such as FAS, ACC, HMGCR, and LDLR. [score:4]
To directly assess the effect of miR-33 on these predicted target genes, we cloned the 3′UTR of HMGCR and SREBP1 into luciferase reporter plasmids. [score:4]
demonstrates that long-term anti-miR-33 therapy results in a pronounced upregulation of major urinary proteins that can make up 5% of the total RNA transcripts in the male murine liver. [score:4]
In addition to the effect of miR-33 in controlling cholesterol efflux and HDL-C synthesis, miR-33 also regulates the expression of genes involved in fatty acid oxidation and insulin signaling, including CROT, CPT1A, HADHB, AMPK, and IRS2 (Gerin et al, 2010; Davalos et al, 2011). [score:4]
Note the pronounced upregulation of MUP (white box) in response to miR-33 ASO. [score:4]
These effects appear to be mediated by the upregulation of genes involved in fatty acid synthesis in the liver of mice treated with miR-33 ASOs. [score:4]
Instead, we found that NFYC, a member of the three NF-Y subunits required for DNA binding and full transcriptional activation of SREBP-responsive genes, was upregulated in the livers of mice administered with miR-33 ASO. [score:4]
Interestingly, SRC3- and RIP140 -deficient mice are resistant to obesity and hepatic steatosis, suggesting that the upregulation of these genes observed in anti-miR-33 -treated mice might result in lipid accumulation in the liver (Leonardsson et al, 2004; Coste et al, 2008). [score:4]
However, we could not identify SREBP1 as a direct target of miR-33 using 3′UTR luciferase experiments. [score:4]
A qRT-PCR analysis of hepatic miR-33 expression levels in the livers of mice treated with PBS, control ASO, or miR-33 ASO, and fed a chow diet (CD). [score:3]
demonstrates that prolonged anti-miR-33 therapy results in marked changes in protein expression. [score:3]
Moreover, we also found increased levels of ApoB-100, the main VLDL/LDL -associated lipoprotein, in mice treated with miR-33 inhibitors (Fig 1K). [score:3]
To gain insights into the functional importance of miR-33 in humans, two independent groups assessed the efficacy of inhibiting miR-33 in non-human primates. [score:3]
Because HDL-C levels and increased reverse cholesterol transport (RCT) have shown a strong inverse correlation with atherosclerotic vascular disease, several groups decided to study the efficacy of anti-miR-33 therapy during the progression and regression of atherosclerosis. [score:3]
Recent studies have demonstrated that specific inhibition of a tiny RNA (miR-33) results in increased circulating HDL levels and prevents against the progression of atherosclerosis. [score:3]
Finally, we further explored the impact of long-term miR-33 treatment on hepatic protein expression using a proteomic approach. [score:3]
Even though these results are promising for treating cardiovascular diseases, the safety and physiological effect of prolonged miR-33 silencing remains to be elucidated. [score:3]
We and others have previously shown that short-term treatment with miR-33 inhibitors markedly increases plasma HDL-C levels and enhances the regression of atherosclerosis (Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010, 2011a, b; Horie et al, 2013). [score:3]
Importantly, NFYC, a miR-33 target gene and a co-activator of the SREBP genes, was also increased in the livers of mice treated with miR-33 ASO. [score:3]
Even though all these studies strongly demonstrate that manipulation of miR-33 levels in vivo markedly influences lipid metabolism and atherogenesis, the absence of miR-33b in rodents limits the translational and physiological relevance of these findings. [score:3]
Carlos Fernandez-Hernando has patents on the use of miR-33 inhibitors. [score:3]
Importantly, the expression level of genes involved in fatty acid synthesis, such as NFYC, SREBP1, ACC, and FASN, was also increased in miR-33 ASO -treated mice (Fig 2F). [score:3]
Mechanistically, they found that miR-33 -deficient mice have increased SREBP1 expression and activation, leading to a transcriptional activation of genes involved in fatty acid synthesis. [score:3]
K Representative Western blot of plasma ApoB-100 expression of mice treated with PBS, control ASO, or miR-33 ASO and fed a HFD for 20 weeks. [score:3]
A number of studies have recently identified miR-33 as a potential therapeutic target for treating cardiometabolic disorders including atherosclerosis and metabolic syndrome (Rayner et al, 2011b; Horie et al, 2012, 2013). [score:3]
Further studies are necessary to understand the complex gene regulatory network controlled by miR-33, as well as the role of miR-33 in regulating metabolism in individual tissues such as the liver, adipose tissue, and brain. [score:3]
G qRT-PCR analysis of hepatic miR-33 expression levels of mice treated with PBS, control ASO, or miR-33 ASO, and fed a high-fat diet (HFD). [score:3]
In addition to the established role of miR-33 in controlling plasma HDL levels, inhibition of miR-33 in vitro markedly increases fatty acid oxidation (Davalos et al, 2011), suggesting that anti-miR-33 therapy might be useful to reduce hepatic lipid accumulation and treat patients with NAFLD. [score:3]
Figure 1 A qRT-PCR analysis of hepatic miR-33 expression levels in the livers of mice treated with PBS, control ASO, or miR-33 ASO, and fed a chow diet (CD). [score:3]
However, the fact that the genetic ablation of miR-33 protects against the progression of atherosclerosis in apoE [−/−] mice suggests that long-term anti-miR-33 therapy should be beneficial for treating atherosclerotic vascular disease (Horie et al, 2012). [score:3]
While Moore and Temel's study claimed a marked reduction of plasma VLDL-TGs (Rayner et al, 2011a), Näär and colleagues reported that the inhibition of miR-33 in non-human primates does not influence circulating VLDL-TGs (Rottiers et al, 2013). [score:3]
Importantly, hepatic expression of genes involved in fatty acid synthesis such as FAS, ACC, and SREBP1 was increased in mice treated with miR-33 antisense oligonucleotides. [score:3]
Nevertheless, the adverse effects reported in miR-33 -deficient mice and in this study raise awareness that long-term inhibition of miR-33 might cause adverse effects, such us hypertriglyceridemia and hepatic steatosis. [score:3]
Since increased RCT correlates inversely with the incidence of coronary artery disease, several groups studied the efficacy of anti-miR-33 therapy during the progression and regression of atherosclerosis. [score:3]
We treated mice fed a chow diet and high-fat diet with miR-33 inhibitors (miR-33 ASO). [score:3]
Even though these studies are encouraging, the effect of prolonged miR-33 inhibition has not been studied yet. [score:3]
Therefore, antagonism of miR-33 in vivo could potentially represent a novel therapy for treating major risk factors associated with metabolic syndrome including low HDL-C, hypertriglyceridemia, insulin resistance, and non-alcoholic fatty liver disease. [score:3]
The most remarkable difference between the miR-33 antisense therapy and genetic studies is that the ability to increase plasma HDL-C levels was lost in the two progression studies using anti-miR-33 oligos, while miR-33 [−/−] apoE [−/−] mice still had increased circulating HDL-C. These results suggest that miR-33 ASO delivery may not completely inhibit miR-33 activity in the liver. [score:3]
Taken together, our findings demonstrate that long-term pharmacological inhibition of miR-33 leads to dyslipidemia and moderate hepatic steatosis. [score:3]
To gain insights into the potential mechanism behind the hypertriglyceridemia observed in mice treated with miR-33 ASO, we analyzed the effect of anti-miR-33 therapy on hepatic lipid metabolism and gene expression. [score:3]
Unexpectedly, we found that chronic inhibition of miR-33 results in hypertriglyceridemia and moderate hepatic steatosis. [score:3]
These findings open new questions about how miR-33 regulates lipid and glucose metabolism at the organismal level. [score:2]
This finding was not unexpected given the role of miR-33 in regulating glucose metabolism. [score:2]
In addition to NFYC, we found that SRC1 and RIP140, two transcriptional regulators that control adipogenesis and lipid metabolism, were derepressed in mice treated with miR-33 ASO (Fig 2). [score:2]
Indeed, a bioinformatic analysis of biological processes shows that the proteins altered in the liver of mice administered with miR-33 ASO were significantly enriched (FDR< 0.001) for the regulation of glucose metabolism as well as other metabolic processes (Supplementary Fig S2). [score:2]
Further research is required to better understand the complex gene regulatory network controlled by miR-33. [score:2]
Transcriptional activation of SREBP1 and SREBP2 also increases miR-33a and miR-33b levels, suggesting that miR-33a/b are regulated with their host genes (Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010). [score:2]
Similar to mice fed a chow diet, hepatic miR-33 expression was significantly reduced in mice receiving miR-33 ASO compared to PBS or Cont ASO (Fig 1G). [score:2]
Taken together, these results demonstrate the complex network of genes that miR-33 regulates. [score:2]
Similar to our previous short-term studies, miR-33 ASO -treated mice showed a marked reduction of hepatic miR-33 expression (Fig 1A) and had increased total cholesterol and HDL-C (Fig 1B and C) compared with those receiving PBS or control anti-miR (Cont ASO). [score:2]
Finally, we found that nuclear transcription Y subunit gamma (NFYC), a miR-33 target gene, was markedly increased in mice administered with miR-33 ASO compared to control miRNA -treated mice. [score:2]
LG, AS, AB, MM, and CFH conceived and designed the experiments; LG, AS, CMR, RMA, LG, XY, SL, and AW performed the experiments; LG, AS, CMR, AW, LG, RMA, XY, SL, EAF, YS, AB, MM, and CFH analyzed the data; CE provided control and anti-miR-33 oligonucleotides; LG and CFH wrote the manuscript. [score:1]
Therefore, we assessed the long-term efficacy of anti-miR-33 therapy in controlling lipid metabolism. [score:1]
Figure 3A, B Liver protein extracts from control ASO (green color) and miR33 ASO -treated (red color) mice were quantified using difference gel electrophoresis (DIGE, n = 4 per group) (A). [score:1]
Moreover, they highlight the marked effect that prolonged anti-miR-33 therapy causes in multiple metabolic pathways. [score:1]
Analysis of the plasma lipoprotein distribution showed that miR-33 ASO -treated mice had a significant increase in cholesterol associated with the HDL fraction and TGs in the VLDL fraction (Fig 1L and M). [score:1]
Here, we demonstrate that long-term treatment with miR-33 ASO in mice fed a CD increases plasma HDL-C levels without any adverse effect. [score:1]
We further analyzed the effect of long-term administration of miR-33 ASO in high-fat diet (HFD) fed mice. [score:1]
These studies demonstrated in most cases that antagonism of miR-33 in vivo delays the progression and enhances the regression of atherosclerosis (Rayner et al, 2011b; Marquart et al, 2013; Rotllan et al, 2013). [score:1]
were reproduced by using a dye-swap (B): control ASO (red color), miR-33 ASO (green color). [score:1]
The human genome encodes for two isoforms of miR-33: miR-33a, which is encoded within intron 16 of the SREBP2 gene and miR-33b, which is located within intron 17 of the SREBP1 gene. [score:1]
E, F Circulating triglyceride (TG) levels (E) and body weight (F) of mice injected with PBS, control ASO, or miR-33 ASO, and fed a CD. [score:1]
Interestingly, the hepatic lipid accumulation was only observed in miR-33 ASO -treated mice fed a HFD but not in mice fed a CD (Fig 2A–E). [score:1]
Recently, we and others have identified a highly conserved family of miRNAs, miR-33a/b, embedded within the intronic sequences of SREBP genes (Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010). [score:1]
Prolonged miR-33 silencing results in significant alterations in enzymes associated with glucose metabolism. [score:1]
were randomized into three groups (n = 15 mice): no treatment (PBS), 2′F/MOE anti-miR-33 (TGCAATGCAACTACAATGCAC) oligonucleotide, and 2′F/MOE mismatch control (TCCAATCCAACTTCAATCATC) oligonucleotide (the mismatched bases are underlined). [score:1]
Most of the previous studies using miR-33 ASOs were performed over a short period of time and using atheroprone mouse mo dels such as apoE [−/−] and Ldlr [−/−] mice. [score:1]
Of note, antagonism of miR-33 in vivo or genetic ablation of miR-33 results in a significant increase of circulating high-density lipoprotein cholesterol (HDL-C) levels (Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010). [score:1]
D Lipoprotein profile analysis obtained from pooled plasma of mice administered PBS, control ASO, or miR-33 ASO. [score:1]
While Baldan's group found that a 12-week anti-miR-33 therapy failed to sustain increased circulating HDL-C and prevent atherogenesis (Marquart et al, 2013), we reported that miR-33 ASO successfully reduced the progression of atherosclerosis despite the insignificant alteration of HDL-C levels (Rotllan et al, 2013). [score:1]
Interestingly, we found that miR-33 has predicted binding sites in the 3′UTR of SREBP1 and HMGCR (Supplementary Fig S1A). [score:1]
Surprisingly, we found that prolonged silencing of miR-33 results in hepatic lipid accumulation and increased plasma TG levels in mice fed a HFD. [score:1]
Surprisingly, we found that long-term administration of miR-33 ASO results in hypertriglyceridemia and moderate hepatic steatosis. [score:1]
To determine the efficacy of long-term anti-miR-33 therapy in raising plasma HDL-C levels and preventing hepatic steatosis, we administered miR-33 ASO to mice fed a CD (12 weeks) and HFD (20 weeks). [score:1]
However, the efficacy of anti-miR-33 therapy on the progression of atherosclerosis is controversial (Horie et al, 2012; Marquart et al, 2013; Rotllan et al, 2013). [score:1]
Our findings provide the first evidence that long-term anti-miR-33 therapy results in adverse effects, including hypertriglyceridemia and moderate hepatic steatosis. [score:1]
Anti-miR-33 therapy causes a profound alteration in the liver proteome. [score:1]
We found that proteins involved in glucose metabolism were highly altered in mice treated with miR-33 ASO (Supplementary Table S1). [score:1]
These results were similar to those reported here using miR-33 ASO. [score:1]
Thus, in the present study, we tested the efficacy of long-term anti-miR-33 therapy on lipoprotein metabolism and the hepatic lipid profile in C57BL/6 mice fed a chow diet (CD) or high-fat diet (HFD). [score:1]
Nevertheless, miR-33 [−/−] /apoE [−/−] -deficient mice developed smaller atherosclerotic plaques than apoE [−/−] mice (Horie et al, 2012). [score:1]
Mmu-miR-33 quantification and quantitative real-time PCR were performed in triplicate using SYBR Green Master Mix (SA Biosciences) on an iCycler Real-Time Detection System (Eppendorf). [score:1]
K Representative of ABCA1, NPC1, SRC1, RIP140, CROT, and NFYC from liver lysates of mice treated with PBS, control ASO, or miR-33 ASO. [score:1]
Long-term anti-miR-33 therapy results in hypertriglyceridemia in mice fed a HFD. [score:1]
In the single-regression study published, Moore's group demonstrated that 4-week treatment with 2′F/MOE anti-miR-33 oligonucleotides accelerated the regression of atherosclerosis in Ldlr [−/−] mice with established atherosclerotic plaques (Rayner et al, 2011b). [score:1]
Treatment of African green monkeys with anti-miR-33 oligonucleotides significantly increased circulating HDL-C (30–40%) in both studies (Rayner et al, 2011a; Rottiers et al, 2013). [score:1]
Data information: All the data represent the mean ± SEM; (PBS n = 10, control ASO n = 12 and miR-33 ASO n = 12) and * P < 0.05 comparing miR-33 ASO group with PBS and control ASO groups. [score:1]
Furthermore, neutral lipid staining using Oil Red O confirmed the accumulation of lipids in mice treated with miR-33 ASO (Fig 2E). [score:1]
A–D Hepatic content of triglycerides (A), diglycerides (B), free fatty acids (C), and cholesterol esters (D) quantified from liver tissue of mice treated with PBS, control ASO, or miR-33 ASO for 20 weeks and fed a chow diet (CD) or high-fat diet (HFD). [score:1]
Collectively, these results suggest that while prolonged miR-33 ASO treatment in chow-fed mice increases circulating HDL-C without affecting plasma TG levels, long-term anti-miR-33 therapy in HFD-fed mice results in hypertriglyceridemia. [score:1]
Antagonism miR-33 in mice fed a HFD results in moderate hepatic steatosis. [score:1]
N Body weight of mice treated with PBS, control ASO, or miR-33 ASO for 20 weeks and fed HFD. [score:1]
While miR-33b conservation is lost in lower mammals, including rodents, miR-33a is highly conserved from Drosophila to humans. [score:1]
A, B Liver protein extracts from control ASO (green color) and miR33 ASO -treated (red color) mice were quantified using difference gel electrophoresis (DIGE, n = 4 per group) (A). [score:1]
Long-term anti-miR-33 therapy increases plasma triglyceride levels in high-fat diet fed mice. [score:1]
L, M Cholesterol (L) and triglyceride (M) distribution in different lipoprotein fractions isolated from mice treated with PBS, control ASO, or miR-33 ASO, and fed a HFD. [score:1]
Previous short-term studies (4 weeks) showed that mice fed a chow diet (CD) and treated with anti-miR-33 oligonucleotides have increased circulating HDL-C without affecting the cholesterol distribution in other lipoproteins fractions. [score:1]
Data represent the mean ± SEM; (PBS n = 3, control ASO n = 6 and miR-33 ASO n = 6) and * P < 0.05 comparing PBS and miR-33 ASO group with control ASO group. [score:1]
Data represent the mean ± SEM; (PBS n = 3, control ASO n = 6 and miR-33 ASO n = 6) and * P < 0.05 comparing miR-33 ASO group with PBS and control ASO group. [score:1]
H-J Plasma cholesterol (H), HDL-C (I) and triglyceride (J) levels of mice treated with PBS, control ASO, or miR-33 ASO for 4 and 12 weeks and fed a HFD. [score:1]
B, C Plasma cholesterol (B) and HDL-C (C) levels in the livers of mice treated with PBS, control ASO, or miR-33 ASO for 4 and 12 weeks and fed a CD. [score:1]
Of note, numerous genes associated with glucose and lipid metabolism were altered in miR-33 ASO -treated mice. [score:1]
These reports demonstrated that miR-33 silencing in mice results in increased circulating HDL-C and bile secretion, thereby enhancing mobilization of sterols accumulated from the peripheral tissue through the reverse cholesterol transport (RCT) pathway (Rayner et al, 2011b; Allen et al, 2012). [score:1]
Similarly, non-human primates treated with anti-miR-33 oligonucleotides also exhibit increased HDL-C levels (Rayner et al, 2011a; Rottiers et al, 2013). [score:1]
Surprisingly, plasma TG levels were also significantly elevated in mice receiving miR-33 ASO (Fig 1J). [score:1]
To determine whether long-term anti-miR-33 therapy was also efficient in increasing plasma HDL-C, we treated C57BL6 mice with 2′fluoro/methoxyethyl (2′F/MOE) phosphorothioate-backbone -modified anti-miR-33 oligonucleotides (miR-33 ASO). [score:1]
Chronic miR-33 ASO administration results in moderate hepatic steatosis. [score:1]
Similar to our results, Horie and colleagues have recently reported that miR-33 [−/−] mice develop obesity, fatty liver, and hypertriglyceridemia. [score:1]
F–J qRT-PCR analysis of genes involved in fatty acid synthesis (F), cholesterol metabolism (G), fatty acid oxidation and lipolysis (H), glucose metabolism (I) and lipoprotein metabolism (J) in liver tissues from mice treated with PBS, control ASO or miR-33 ASO. [score:1]
Figure 2A–D Hepatic content of triglycerides (A), diglycerides (B), free fatty acids (C), and cholesterol esters (D) quantified from liver tissue of mice treated with PBS, control ASO, or miR-33 ASO for 20 weeks and fed a chow diet (CD) or high-fat diet (HFD). [score:1]
COS7 cells were plated into 12-well plates and co -transfected with 1 μg of the indicated 3′UTR luciferase reporter vectors and miR-33 mimics or control mimics (CM) (Life Technologies) utilizing Lipofectamine 2,000 (Invitrogen). [score:1]
Further studies will be important for elucidating the molecular mechanism and tissue specificity by which miR-33 controls cholesterol, fatty acid, and glucose metabolism. [score:1]
Liver lysates were obtained from mice treated with miR-33 ASO or Cont ASO and fed a HFD for 20 weeks. [score:1]
Together, these data suggest that prolonged anti-miR-33 therapy in mice fed a HFD could be deleterious for treating atherosclerosis and dyslipidemias. [score:1]
E Representative liver sections isolated from mice treated with PBS, control ASO, or miR-33 ASO stained with H&E, picrossirius red, and Oil Red O. Scale bar = 70 μm. [score:1]
[1 to 20 of 123 sentences]
8
[+] score: 246
Having shown that JEV infection downregulates miR-33a-5p expression and that miR-33a-5p targets EEF1A1 mRNA, we hypothesized that JEV infection may upregulate EEF1A1 expression. [score:13]
JEV infection inhibits miR-33a-5p expression and maturation, whereas miR-33a-5p targets EEF1A1, so in JEV-infected cells EEF1A1 was upregulated. [score:10]
In addition to confirming that miR-33a-5p is downregulated after JEV infection, this result suggests a potential mechanism by which JEV downregulates miR-33a-5p expression. [score:9]
We used publically available miRNA target-prediction algorithms TargetScan, PIT, Pictar, and miRanda to identify miR-33a-5p targets with potential relevance to the regulation of JEV replication. [score:8]
The sequences of the mimics, inhibitors, or scrambled oligonucleotides were as follows: miR-33a-5p mimics, 5′-GUGCAUUGUAGUUGCAUUGCA-3′ (forward) and 5′-CAAUGCAACUACAAUGCACUU-3′ (reverse); mimic negative controls, 5′-UUCUCCGAACGUGUCACGUTT-3′ (forward) and 5′-ACGUGACACGUUCGGAGAATT-3′ (reverse); miR-33a-5p inhibitor, 5′-UGCAAUGCAACUACAAUGCAC-3′; and inhibitor negative control, 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:7]
Overexpression of miR-33a-5p resulted in a significant reduction in EEF1A1 at both transcriptional and posttranscriptional levels, whereas the application of miR-33a-5p inhibitor restored the expression of EEF1A1 (Fig. 3E to G). [score:7]
In summary, this study showed that miR-33a-5p level was downregulated after JEV infection, and EEF1A1 was identified as a novel target of miR-33a-5p. [score:6]
Here, we identified EEF1A1 as a novel target of miR-33a-5p that is upregulated by JEV infection in a time -dependent manner. [score:6]
We found that miR-33a-5p negatively regulates JEV replication by targeting eukaryotic translation elongation factor 1A1 (EEF1A1), thus clarifying one of the molecular mechanisms underlying JEV pathogenesis. [score:6]
In the present study, we found that JEV infection downregulated the expression of endogenous cellular miR-33a-5p. [score:6]
FIG 1JEV infection downregulates miR-33a-5p expression. [score:6]
As shown in Fig. 8, cotransfection of miR-33a-5p mimics and vector markedly reduced JEV replication, whereas cotransfection of miR-33a-5p mimics and Myc-tagged EEF1A1 plasmid countervailed the inhibition, indicating that miR-33a-5p negatively regulates JEV replication by targeting EEF1A1. [score:6]
To further validate this mechanism, JEV-infected EEF1A1-knockdown cells or miR-33a-5p -overexpressed cells were treated with proteasomal inhibitor, MG132. [score:6]
As shown in Fig. 2, the overexpression of miR-33a-5p significantly inhibited JEV replication in a dose -dependent manner (Fig. 2E), indicating that miR-33a-5p acts as a negative regulator for JEV replication in HEK293T cells. [score:6]
JEV infection downregulates miR-33a-5p expression. [score:6]
These data indicate that JEV infection downregulates miR-33a-5p expression at transcriptional level in HEK293T cells. [score:6]
Wang JM, Zhou JJ, Zheng Q, Gan H, Wang H 2014 Dialysis method alters the expression of microRNA-33a and its target genes ABCA1, ABCG1 in THP-1 macrophages. [score:5]
miR-33a is an intronic microRNA that coordinately expressed with its host gene SREBP-2. In each case, changes in miR-33a expression were closely paralleled by changes in SREBP-2 mRNA (41, 43). [score:5]
MiR-33a-5p expression was downregulated after JEV infection, but the difference was not significant compared to the control in the first 12 h, indicating that miR-33a-5p exerts its function mainly at the late stages of JEV infection. [score:5]
miR-33a-5p, which showed an obviously downregulated pattern upon JEV infection and has rarely been reported to be involved in virus infections, was selected for further study. [score:4]
These results suggested that EEF1A1 is a direct target of miR-33a-5p. [score:4]
To determine miR-33a-5p expression was regulated at which step, primary (pri)- and precursor (pre)-miR-33a-5plevels were checked, and similar downward trends were observed in both of them (Fig. 1C and D). [score:4]
We found EEF1A1 as a direct target of miR-33a-5p. [score:4]
In our study, we observed that SREBP-2 mRNA level was also downregulated after JEV infection (data not shown), showing the same trend as miR-33a-5p. [score:4]
A dual-luciferase reporter assay identified eukaryotic translation elongation factor 1A1 (EEF1A1) as one of the miR-33a-5p target genes. [score:4]
miR-33a-5p -mediated regulation of JEV replication is achieved through targeting EEF1A1. [score:4]
Taken together, these results suggest that miR-33a-5p is downregulated during JEV infection, which contributes to viral replication by increasing the intracellular level of EEF1A1, an interaction partner of JEV NS3 and NS5. [score:4]
To confirm that this reduction in luciferase activity was indeed due to interaction of miR-33a-5p with the 3′ UTR of EEF1A1, a mutant dual luciferase reporter containing four base pair mutations in the seed region was also cotransfected into HEK293T cells, together with miR-33a-5p mimics or inhibitors (Fig. 3D). [score:4]
miR-33a-5p inhibits JEV replication. [score:3]
To further validate the impact of interaction between miR-33a-5p and the EEF1A1 3′ UTR, expression of endogenous EEF1A1 was measured in HEK293T cells treated with miR-33a-5p mimics or inhibitors. [score:3]
Human miR-33a-5p mimics, inhibitors, and their controls were purchased from GenePharma. [score:3]
As expected, no significant effect of either miR-33a-5p mimics or inhibitors was observed (Fig. 3D). [score:3]
In previous studies, miR-33a-5p was mainly shown to target the cellular cholesterol efflux transporter ATP -binding cassette transporter A1, which plays an important role in lipid metabolism (43, 47 – 49). [score:3]
It was found that overexpression of miR-33a-5p significantly decreased the interaction amount between EEF1A1 and viral replicase components (Fig. 7A). [score:3]
To determine whether EEF1A1 mRNA is indeed a target of miR-33a-5p, we then constructed dual-luciferase reporter plasmids carrying the EEF1A1 3′ UTR with the wild-type or base pair mutant miR-33a-5p binding region (Fig. 3B and C). [score:3]
FIG 3 (A) Sequence alignments of miR-33a-5p in different species and its target sites in 3′ UTR of EEF1A1. [score:3]
miR-33a-5p mimics and inhibitors. [score:3]
Wijesekara N, Zhang LH, Kang MH, Abraham T, Bhattacharjee A, Warnock GL, Verchere CB, Hayden MR 2012 miR-33a modulates ABCA1 expression, cholesterol accumulation, and insulin secretion in pancreatic islets. [score:3]
In contrast, the luciferase activity increased after treatment with miR-33a-5p inhibitors. [score:3]
Recent studies have demonstrated that human miR-33a-5p overexpression significantly reduces HIV particle production in MT2 and primary T CD4 [+] cells, indicating that miR-33a-5p plays an important role in HIV infection (46). [score:3]
EEF1A1 is a target of miR-33a-5p. [score:3]
Many studies have reported functions for miR-33a, but most focus on its involvement in lipid and glucose metabolism, cancer development, and the regulation of cell proliferation (40 – 43). [score:3]
Cells were harvested at 36 h postinfection, and quantitative real-time PCR was performed to determine the expression of miR-33a-5p. [score:3]
The sequences of miR-33a-5p and its target site in the 3′ UTR of EEF1A1 were aligned with those from different species, and these sequences are shown to be highly conserved among species (Fig. 3A). [score:3]
FIG 9Proposed mo del of regulatory role of miR-33a-5p in JEV infection. [score:2]
Fang Y, Feng Y, Wu T, Srinivas S, Yang W, Fan J, Yang C, Wang S 2013 Aflatoxin B1 negatively regulates Wnt/β-catenin signaling pathway through activating miR-33a. [score:2]
Notably, artificially transfecting with miR-33a-5p mimics led to a significant decrease in viral replication, suggesting that miR-33a-5p acts as a negative regulator of JEV replication. [score:2]
To our knowledge, this is the first study to demonstrate the importance of EEF1A1 in JEV replication and the regulation of EEF1A1 via miR-33a-5p. [score:2]
The present study explores a novel role of miR-33a-5p as a negative regulator of JEV replication. [score:2]
Horie T, Ono K, Horiguchi M, Nishi H, Nakamura T, Nagao K, Kinoshita M, Kuwabara Y, Marusawa H, Iwanaga Y, Hasegawa K, Yokode M, Kimura T, Kita T 2010 MicroRNA-33 encoded by an intron of sterol regulatory element -binding protein 2 (Srebp2) regulates HDL in vivo. [score:2]
miR-33a-5p is one of the mature forms of miR-33a. [score:1]
The miR-33a-5p level decreased over time accompanied by the increasing amount of virus titer after JEV infection (Fig. 1A). [score:1]
Further, we infected HEK293T cells with JEV P3 at different MOIs and found that miR-33a-5p level decreased significantly in a virus load -dependent manner (Fig. 1B). [score:1]
Through miRNA sequencing, we identified miR-33a-5p as our research focus. [score:1]
NS3 and NS5 proteins were immunoprecipitated from the JEV-infected cells that were initially transfected with EEF1A1 shRNA, miR-33a-5p mimics or their controls and then subjected to Western blotting with anti-NS3, anti-NS5, and anti-K48-ubiquitin antibodies. [score:1]
To fully illustrate the relationship among miR-33a-5p, EEF1A1, and JEV, HEK293T cells were cotransfected with miR-33a-5p mimics or control miRNA mimics and Myc-tagged EEF1A1 plasmid or vector, followed by JEV infection or JEV replicon transfection. [score:1]
Huang CF, Sun CC, Zhao F, Zhang YD, Li DJ 2014 miR-33a levels in hepatic and serum after chronic HBV -induced fibrosis. [score:1]
Ibrahim AF, Weirauch U, Thomas M, Grunweller A, Hartmann RK, Aigner A 2011 MicroRNA replacement therapy for miR-145 and miR-33a is efficacious in a mo del of colon carcinoma. [score:1]
The level of miR-33a-5p was determined by quantitative real-time PCR (upper panel). [score:1]
The level of pre-miR-33a-5p (C) and pri-miR-33a-5p (D) were determined by quantitative real-time PCR. [score:1]
At 24 h, the miR-33a-5p level was significantly lower than in mock-infected cells (Fig. 1A). [score:1]
Here, we examined the role of cellular miR-33a-5p on JEV infection. [score:1]
Although miR-33a participates in HBV and HCV infection, this has been attributed to its involvement in fatty acid metabolism (44, 45). [score:1]
HEK293T cells were transfected with miR-33a-5p mimics or control mimics and, 24 h later, the cells were infected with JEV at an MOI of 1.0. [score:1]
To validate this hypothesis, anti-NS5 antibody was used to pull down the NS5-containing replicase complex from JEV-infected cells transfected with miR-33a-5p mimics. [score:1]
Lendvai G, Jarmay K, Karacsony G, Halasz T, Kovalszky I, Baghy K, Wittmann T, Schaff Z, Kiss A 2014 Elevated miR-33a and miR-224 in steatotic chronic hepatitis C liver biopsies. [score:1]
Relatively little has been reported about the involvement of miR-33a in viral infections. [score:1]
In our study, we found that human miR-33a-5p also plays a critical role in JEV infection. [score:1]
To assess the level of miR-33a-5p in HEK293T cells, the cells were infected with JEV strain P3 (MOI = 1.0) and harvested at various time points. [score:1]
To test whether miR-33a-5p has a biological function in viral replication, HEK293T cells were transfected with miR-33a-5p mimic or control miRNA mimic, followed by JEV infection. [score:1]
The luciferase activity markedly decreased when cells were cotransfected with the miR-33a-5p mimic and wild-type EEF1A1 3′-UTR luciferase reporter. [score:1]
[1 to 20 of 71 sentences]
9
[+] score: 215
MiR-33 Target Genes Were Altered in the Livers of MiR-33 [−/−] Mice on an Apoe [−/−]It has already been shown that miR-33 targets several genes that affect cholesterol and fatty acid synthesis. [score:5]
Previously, we and others have shown that miR-33 targeted the 3′ untranslated region (UTR) of Abca1 and Abcg1. [score:5]
However, some of the previously validated targets of miR-33, such as RIP140 and CROT, were upregulated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice, whereas CPT1a and AMPKα were not. [score:5]
[37] Therefore, the enhanced expression of RIP140 under miR-33 deficiency may have affected the expression of IL-6. It is also possible that elevation of M2 markers may indicate the healing process of atherosclerosis in miR-33 [−/−] Apoe [−/−] mice and that the phenotypic changes in macrophages may involve feedback mechanisms. [score:5]
A previous article indicated that the inhibition of miR-33 by antisense oligonucleotide enhanced M2 marker expression in macrophages. [score:5]
ABCA1, ABCG1, and RIP140 were also upregulated in miR-33 [−/−] Apoe [−/−] macrophages. [score:4]
16– 18, 22 mRNA expression of ABCA1 and protein expression of ABCA1 and ABCG1 were significantly increased in PEMs from miR-33 [−/−] Apoe [−/−] mice compared with PEMs from miR-33 [+/+] Apoe [−/−] mice (Figure 5A and 5B). [score:4]
Mice transplanted with miR-33 [−/−] Apoe [−/−] bone marrow showed a significant reduction in lipid content in atherosclerotic plaque compared with mice transplanted with miR-33 [+/+] Apoe [−/−] bone marrow, without an elevation of HDL-C. Some of the validated targets of miR-33 such as RIP140 (NRIP1) and CROT were upregulated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice, whereas CPT1a and AMPKα were not. [score:4]
A recent report indicated that the inhibition of miR-33a/b in nonhuman primates raised plasma HDL-C and lowered VLDL triglyceride levels. [score:3]
These data suggest that it may be possible to inhibit miR-33a and miR-33b pharmacologically to raise HDL-C for the treatment of dyslipidemia and atherosclerosis. [score:3]
Many genes are altered in miR-33 -deficient mice, and detailed experiments are required to establish miR-33 targeting therapy in humans. [score:3]
16– 18 Moreover, antisense inhibition of miR-33 resulted in a regression of the atherosclerotic plaque volume in LDL-receptor -deficient mice. [score:3]
Further detailed experiments will be needed to determine whether targeting miR-33 could be a suitable approach for such treatment. [score:3]
Thus, the suppression of miR-33 in macrophages may also be beneficial for the prevention of plaque rupture. [score:3]
[38] RIP140 has been shown to be one of the targets of miR-33. [score:3]
It has already been shown that miR-33 targets several genes that affect cholesterol and fatty acid synthesis. [score:3]
These results indicated that miR-33 expression in macrophages did not contribute to serum HDL-C levels, which is consistent with the results that the liver and intestine are the major sources of HDL-C. 39, 40 Table 2. Serum Lipid Profiling of MiR-33 [+/+] Apoe [−/−] Mice Transplanted With MiR-33 [+/+] Apoe [−/−] and MiR-33 [−/−] Apoe [−/−] BM by Standard Method TC, mg/dL HDL-C, mg/dL LDL-C, mg/dL TG, mg/dLmiR-33 [+/+] Apoe [−/−] BM recipient (n=6) 833.5±70.4 12.0±1.4 195.0±15.2 56.3±8.3miR-33 [−/−] Apoe [−/−] BM recipient (n=8) 984.9±54.7 12.1±1.3 209.9±9.0 43.9±6.6 P NS NS NS NS Values are mean±SE. [score:3]
These results indicated that miR-33 expression in macrophages did not contribute to serum HDL-C levels, which is consistent with the results that the liver and intestine are the major sources of HDL-C. 39, 40 Table 2. Serum Lipid Profiling of MiR-33 [+/+] Apoe [−/−] Mice Transplanted With MiR-33 [+/+] Apoe [−/−] and MiR-33 [−/−] Apoe [−/−] BM by Standard Method TC, mg/dL HDL-C, mg/dL LDL-C, mg/dL TG, mg/dLmiR-33 [+/+] Apoe [−/−] BM recipient (n=6) 833.5±70.4 12.0±1.4 195.0±15.2 56.3±8.3miR-33 [−/−] Apoe [−/−] BM recipient (n=8) 984.9±54.7 12.1±1.3 209.9±9.0 43.9±6.6 P NS NS NS NS Values are mean±SE. [score:3]
Previously, we and others showed that miR-33 targets ABCA1 in macrophages and the liver. [score:3]
These results indicate that miR-33 deficiency improved macrophage cholesterol efflux by increasing the expressions of macrophage ABCA1 and ABCG1. [score:3]
Thioglycollate-elicited peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice were cultured in the presence or absence of acLDL plus ACAT inhibitor for 24 hours. [score:3]
[19] miR-33 deficiency also reduced the expression of VCAM-1, which may have influenced atherosclerotic plaque formation. [score:3]
In this study, we showed that ABCA1 and CROT in the livers of miR-33 [−/−] Apoe [−/−] mice were upregulated compared with those in miR-33 [+/+] Apoe [−/−] mice, whereas CPT1a and AMPKα were not. [score:3]
Figure 7. miR-33 deficiency reduced the iNOS -positive areas in atherosclerotic plaque and induced coordinated M1 and M2 marker expression in PEMs. [score:3]
Moreover, the real targets of miR-33 in vivo can only be clarified by the genetic deletion of miR-33, and the results obtained by antisense oligonucleotide -based medicine may be different from those obtained in miR-33 -deficient mice. [score:3]
MiR-33 Target Genes Were Altered in the Livers of MiR-33 [−/−] Mice on an Apoe [−/−] Background. [score:2]
To obtain miR-33 and apoE double -knockout mice (miR-33 [−/−] Apoe [−/−]), miR-33 [−/−] mice were mated with Apoe [−/−] mice, which were backcrossed to C57BL/6 mice for 10 generations. [score:2]
Together, these data demonstrate that miR-33 deficiency serves to raise HDL-C, improve cholesterol efflux in macrophages, and prevent the progression of atherosclerosis and suggest that miR-33 should be considered as a potential target to prevent the progression of atherosclerosis. [score:2]
To elucidate the contribution of miR-33 in macrophages to the development of atherosclerosis in vivo, we used bone marrow transplantation (BMT) to generate Apoe [−/−] mice selectively deficient in leukocyte miR-33. [score:2]
20– 22 Because both knockout mice had a BL/6 background, miR-33 [−/−] Apoe [−/−] mice also had a BL/6 background. [score:2]
Treatment of PEMs in culture with acLDL plus ACAT inhibitor (free cholesterol loading) demonstrated that PEMs from miR-33 [−/−] Apoe [−/−] mice were significantly resistant to apoptosis compared with those from miR-33 [+/+] Apoe [−/−] mice. [score:2]
[38] Figure 9. Expression of ABCA1 and CROT in livers and RIP140 in macrophages is elevated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice. [score:2]
[38] Figure 9. Expression of ABCA1 and CROT in livers and RIP140 in macrophages is elevated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice. [score:2]
Recent reports, including ours, have indicated that miR-33 controls cholesterol homeostasis based on knockdown experiments using antisense technology. [score:2]
20, 21 Because both lines have a BL/6 background, miR-33 [−/−] Apoe [−/−] double -knockout mice also had a BL/6 background. [score:2]
Because mice transplanted with miR-33 [−/−] Apoe [−/−] BM showed reduced lipid accumulation in atherosclerotic plaque compared with mice transplanted with miR-33 [+/+] Apoe [−/−] BM, we analyzed free cholesterol (FC)–induced apoptosis in PEMs by treating macrophages with acLDL and acyl-CoA:cholesterol acyl-transferase (ACAT) inhibitor. [score:2]
Our results indicate that miR-33 deficiency raises both HDL-C and macrophage cholesterol efflux and strongly suggest that miR-33 should be considered as a potential target for the prevention of atherosclerosis. [score:2]
The serum lipid profile of recipient mice is shown in Table 2. Serum HDL-C levels of miR-33 [+/+] Apoe [−/−] BM recipients were the same as those in miR-33 [−/−] Apoe [−/−] BM recipients, which were similar to the levels in miR-33 [+/+] Apoe [−/−] mice in Figure 4A. [score:1]
Moreover, the effect of miR-33 deletion in macrophages is not as simple as the shift from the M1 to M2 phenotype reported previously. [score:1]
E, Proportion of the Ly-6C [low] monocyte subset to total monocytes in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
G, Quantitative real-time PCR analysis of proinflammatory (M1) and anti-inflammatory (M2) markers in residual PEMs from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
G, Western analysis of NRIP1 (RIP140) in peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
As shown in Figure 8A and 8B, the VCAM-1 -positive area in atherosclerotic plaque in miR-33 [−/−] Apoe [−/−] was significantly less than that in miR-33 [+/+] Apoe [−/−] mice (P=0.0008). [score:1]
Atherosclerotic lesions were significantly reduced in miR-33 [−/−] Apoe [−/−] mice of both sexes (male: P=0.0314, 0.44±0.025 versus 0.36±0.021 mm [2]; female: P=0.0372, 0.66±0.042 versus 0.54 ± 0.036 mm [2]; Figure 10D and 10E). [score:1]
Values from miR-33 [+/+] Apoe [−/−] were set at 100%. [score:1]
D, Serum apoA-I levels in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice; * P<0.05. [score:1]
As shown in Figure 7A and 7B, the iNOS -positive area in atherosclerotic plaque in miR-33 [−/−] Apoe [−/−] mice was significantly less than that in miR-33 [+/+] Apoe [−/−] mice (P=0.0057). [score:1]
However, there was no difference in total cholesterol, free cholesterol, cholesterol ester, or triglyceride levels in the livers of miR-33 [+/+] Apoe [−/−] mice and miR-33 [−/−] Apoe [−/−] mice (Figure 9D). [score:1]
Figure 8. miR-33 deficiency reduced the VCAM-1 -positive area in atherosclerotic plaque. [score:1]
In the present study, we crossed miR-33 -deficient mice (miR-33 [−/−]) with apoE -deficient mice (Apoe [−/−]) to examine the impact of miR-33 deletion on the progression of atherosclerosis and demonstrated that genetic loss of miR-33 raises circulating HDL-C and decreases atherosclerotic plaque size. [score:1]
These results indicated that deficiency of miR-33 elevated serum cholesterol efflux capacity, possibly through the elevation of HDL-C levels. [score:1]
The results of the present BMT experiment revealed that deletion of macrophage miR-33 significantly reduced the lipid content in atherosclerotic plaque. [score:1]
D, Representative microscopic images of cross-sections of proximal aorta in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male and female mice. [score:1]
Moreover, we assessed the in vivo function of miR-33 deficiency in leukocytes by BMT from miR-33 [+/+] Apoe [−/−] or miR-33 [−/−] Apoe [−/−] mice into miR-33 [+/+] Apoe [−/−] or miR-33 [−/−] Apoe [−/−] mice. [score:1]
The miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice were fed a WTD containing 0.15% cholesterol beginning at age 6 weeks, and atherosclerotic lesions were analyzed at age 22 weeks (Figure 1A). [score:1]
Figure 2. miR-33 deficiency reduced lipid accumulation and macrophage content in atherosclerotic plaque. [score:1]
B, Western analysis of ABCA1, CROT, CPT1a, and AMPKα in livers from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
H, Densitometry of NRIP1 (RIP140) in peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
The total leukocyte count in miR-33 [−/−] Apoe [−/−] mice was significantly less than that in miR-33 [+/+] Apoe [−/−] mice (Figure 6A). [score:1]
Moreover, we measured the level of RIP140 (NRIP1), which has been shown to be one of the targets of miR-33 in macrophages of these mice. [score:1]
We reported previously that miR-33 [−/−] in C57/BL6 mice increases HDL-C by up to 40%. [score:1]
Generation of MiR-33 and ApoE Double-Knockout Mice. [score:1]
We also observed the effect of loss of miR-33 in BMT experiments in miR-33 [−/−] Apoe [−/−] recipients. [score:1]
BM recipients were female miR-33 [+/+] Apoe [−/−] mice (8 weeks old). [score:1]
Figure 11. miR-33 deficiency ameliorated free-cholesterol loading -induced macrophage apoptosis. [score:1]
C, Densitometry of ABCA1, CROT, CPT1a, and AMPKα in livers from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Lipid accumulation area in atherosclerotic lesions was reduced in miR-33 [−/−] Apoe [−/−] mice transplanted with miR-33 [−/−] Apoe [−/−] BM. [score:1]
A, Representative microscopic images of the lipid accumulation area in cross-sections of proximal aorta in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male mice. [score:1]
Peripheral blood was collected from the orbital sinuses of 12-week-old miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice that were given an NC diet using heparin-coated capillary tubes. [score:1]
B, Representative images of the en face analysis of the total aorta in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male mice. [score:1]
B, Representative HPLC analysis of serum cholesterol from male miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Atherosclerotic plaque formation in miR-33 [−/−] Apoe [−/−]mice transplanted with miR-33 [−/−] Apoe [−/−] BM was comparable with that in miR-33 [−/−] Apoe [−/−]mice transplanted with miR-33 [+/+] Apoe [−/−] BM (0.46±0.023 versus 0.42±0.020 mm [2]; Figure 12B and 12C). [score:1]
Figure 5. miR-33 deficiency improved cholesterol efflux in macrophages. [score:1]
[47] This result was obtained from the administration of antisense miR-33 for a certain period. [score:1]
[45] However, we also detected a higher frequency of Ly6C [high] monocytes in miR-33 [−/−] Apoe [−/−] mice than in miR-33 [+/+] Apoe [−/−] mice, and this could enhance inflammation in atherosclerotic plaque. [score:1]
To clarify the role of miR-33 in the progression of atherosclerosis, miR-33 [−/−] mice [22] were mated with Apoe [−/-] mice. [score:1]
C, Representative HPLC analysis of serum cholesterol from female miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Figure 3. miR-33 deficiency reduced CD3 -positive cell accumulation and apoptosis in atherosclerotic plaque. [score:1]
Lipid accumulation area in atherosclerotic lesions was reduced in miR-33 [+/+] Apoe [−/−] mice transplanted with miR-33 [−/−] Apoe [−/−] BM. [score:1]
The ICAM-1 -positive area in miR-33 [−/−] Apoe [−/−] mice tended to be less than that in miR-33 [+/+] Apoe [−/−] mice (P=0.127), shown in Figure 8C and 8D. [score:1]
To further elucidate the effect of miR-33 deletion on the monocyte/macrophage phenotype, we performed a flow-cytometric analysis of circulating monocytes and a quantitative PCR analysis of RNA from PEMs of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
A, Leukocyte count in peripheral blood in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
A, Experimental protocol for bone marrow transplantation from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice to miR-33 [−/−] Apoe [−/−] mice. [score:1]
We found that the loss of miR-33 significantly increased the capacity to promote cholesterol efflux, and this may have contributed to the reduction in atherosclerotic plaque volume. [score:1]
These results showed that loss of miR-33 in blood cells reduced the lipid content of atherosclerotic plaque. [score:1]
We also characterized miR-33 [−/−] Apoe [−/−] macrophages by analyzing the expression of classically activated or proinflammatory (M1) and alternatively activated or anti-inflammatory (M2) macrophage markers using mouse PEMs. [score:1]
The αSMA -positive area was also significantly reduced in miR-33 [−/−] Apoe [−/−] mice (P=0.025 Figure 3C and 3D). [score:1]
[44] Because leukocytosis enhances the progression of atherosclerosis, the reduction in leukocytes observed in miR-33 [−/−] Apoe [−/−] mice may have had a beneficial effects on atherosclerosis. [score:1]
E, HE staining of livers of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice at age 20 weeks fed NC. [score:1]
D, Proportion of the Ly-6C [high] monocyte subset to total monocytes in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
C, Scheme for gating of monocytes using an anti-CD115 antibody, and representative dot plots showing the quantification of Ly-6C [high] and Ly-6C [low] monocyte subsets in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Male mice with genotypes of miR-33 [+/+] Apoe [−/−] and miR33 [−/−] Apoe [−/−] (8 weeks old) were used as bone marrow (BM) donors. [score:1]
We then examined whether miR-33 deficiency influenced the monocyte count or subset frequency in peripheral blood. [score:1]
Free Cholesterol–Induced Apoptosis Was Reduced in PEMs From MiR-33 [−/−] Apoe [−/−] Mice Compared With MiR-33 [+/+] Apoe [−/−] MiceBecause mice transplanted with miR-33 [−/−] Apoe [−/−] BM showed reduced lipid accumulation in atherosclerotic plaque compared with mice transplanted with miR-33 [+/+] Apoe [−/−] BM, we analyzed free cholesterol (FC)–induced apoptosis in PEMs by treating macrophages with acLDL and acyl-CoA:cholesterol acyl-transferase (ACAT) inhibitor. [score:1]
Representative results of the HPLC elution profile of serum of both sexes are shown in Figure 4B and 4C, and lipid profiles are summarized in Table 1. These results show that only the HDL-C level differed between the serum of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
A, Experimental protocol for bone marrow transplantation from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice to miR-33 [+/+] Apoe [−/−] mice. [score:1]
Previous experiments indicated that loss of miR-33 in blood cells reduced lipid accumulation in atherosclerotic plaque. [score:1]
A, Quantitative real-time PCR analysis of Abca1 and Abcg1 in macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Values from miR-33 [+/+] Apoe [−/−] mice were set at 100%. [score:1]
D, Total cholesterol, free cholesterol, cholesterol ester, and triglyceride levels in livers of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
These results indicated that a deficiency of miR-33 decreased atherosclerotic plaque size and lipid content and reduced the accumulation of macrophages and T cells in atherosclerotic plaques. [score:1]
F, Representative microscopic images of immunohistochemical staining for the macrophage marker CD68 in mice transplanted with miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] BM. [score:1]
B, Numbers of monocyte in peripheral blood in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
In any case, the effect of miR-33 deletion in macrophages is not as simple as a shift from the M1 to the M2 phenotype, as described in a previous report. [score:1]
The miR-33 [−/−] Apoe [−/−] mice were born at the expected Men delian ratio, and miR-33 [+/+] Apoe [−/−] littermates were used as controls. [score:1]
Furthermore, loss of leukocyte miR-33 significantly reduced the lipid content in atherosclerotic plaque. [score:1]
Our findings thus far indicate that miR-33 deficiency reduced the accumulation of inflammatory cells in atherosclerotic plaque. [score:1]
)miR-33 [+/+] Apoe [−/−]miR-33 [−/−] Apoe [−/−]miR-33 [+/+] Apoe [−/−]miR-33 [−/−] Apoe [−/−] TC, mg/dL 705.3±72.1 768.4±45.2 598.9±88.8 574.2±70.0 CM (1 to 2), >80 nm 129.2±21.6 157.9±19.8 124.6±20.9 138.6±28.11 VLDL (3 to 7), 30 to 80 nm 419.5±44.1 450.9±30.0 353.6±51.7 322.1±36.4 Large VLDL (3 to 5) 279.3±32.2 316.4±24.9 245.1±35.1 230.2±29. [score:1]
We assessed the impact of the genetic loss of miR-33 in a mouse mo del of atherosclerosis. [score:1]
Male mice with miR-33 [+/+] Apoe [−/−] or miR33 [−/−] Apoe [−/−] genotypes (8 weeks old) were used as bone marrow (BM) donors. [score:1]
Therefore, it was impossible to observe an effect of HDL-C elevation caused by the loss of miR-33 on atherosclerosis in recipients that had the same type of blood cells (Figures 10 and 12). [score:1]
Figure 4. miR-33 deficiency increased HDL-C. A, Serum HDL-C levels determined by standard methods in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male and female mice. [score:1]
We first determined that the total leukocyte count in miR-33 [−/−] Apoe [−/−] mice was less than that in miR-33 [+/+] Apoe [−/−]mice. [score:1]
D, Representative microscopic images of the lipid accumulation area in atherosclerotic lesions in mice transplanted with miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] BM. [score:1]
B, Representative microscopic images of cross-sections of proximal aorta in mice transplanted with miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] BM. [score:1]
BM recipients were female miR-33 [+/+] Apoe [−/−] mice and miR-33 [−/−] Apoe [−/−] mice (8 weeks old). [score:1]
Our results showed that loss of miR-33 in blood cells reduced the lipid content of atherosclerotic plaque, which may be because of improved cholesterol efflux from macrophages. [score:1]
Experimental conditions such as radiation to the liver and intestine may have reduced the effect of miR-33 deficiency on the increase in HDL-C levels in recipient mice after BMT. [score:1]
B, Western blotting analysis of ABCA1 and ABCG1 in thioglycollate-elicited peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Next, to determine the contribution of miR-33 deficiency to atherosclerosis in BM recipients, we transferred BM of miR-33 [+/+] Apoe [−/−] or miR-33 [−/−] Apoe [−/−] mice to miR-33 [−/−] Apoe [−/−] mice in the same way as in the previous BMT experiments (Figure 12A). [score:1]
The mean values of serum HDL-C used in this experiment were 17.8±1.4 versus 19.5±1.8 mg/dL in males and 10.2±0.5 versus 17.3±1.7 mg/dL in females (miR-33 [+/+] Apoe [−/−] versus miR-33 [−/−] Apoe [−/−] mice, n=6 for each group). [score:1]
MiR-33 was barely detectable in BM cells from miR-33 [−/−] Apoe [−/−] BM recipients by quantitative PCR analysis for miR-33 (data not shown). [score:1]
A, Quantitative real-time PCR analysis of Abca1, Crot, Cpt1a, and Prkaa1in livers from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
We previously reported that miR-33 [−/−] mice showed 22% to 39% higher serum HDL-C levels than wild-type mice. [score:1]
MiR-33 [−/−] Apoe [−/−] Mice Transplanted With MiR-33 [−/−] Apoe [−/−] BM Had Reduced Lipid Accumulation in Atherosclerotic PlaqueWe also observed the effect of loss of miR-33 in BMT experiments in miR-33 [−/−] Apoe [−/−] recipients. [score:1]
E, Cholesterol efflux via apoB -depleted serum from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice using [3]H-cholesterol-labeled J774 mouse macrophages. [score:1]
[37] Protein level of RIP140 in miR-33 [−/−] Apoe [−/−] macrophages was significantly increased compared with that in miR-33 [+/+] Apoe [−/−] macrophages (Figure 9F through 9H), which may be one of the reasons why the expression of inflammatory cytokine such as IL-6 in PEMs of miR-33 [−/−] Apoe [−/−] mice was increased compared with that in miR-33 [+/+] Apoe [−/−] mice. [score:1]
F, Quantitative real-time PCR analysis of Nrip1 (RIP140) in peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
[36] The frequency of proinflammatory Ly6C [high] monocytes in miR-33 [−/−] Apoe [−/−] mice was significantly higher than that in miR-33 [+/+] Apoe [−/−] mice (Figure 6B through 6E). [score:1]
MiR-33 and apoE double -knockout mice (miR-33 [−/−] Apoe [−/−]) showed an increase in circulating HDL-C levels with enhanced cholesterol efflux capacity compared with miR-33 [+/+] Apoe [−/−] mice. [score:1]
To elucidate the roles of miR-33 in blood cells, bone marrow transplantation was performed in these mice. [score:1]
Consistent with these results, miR-33 [−/−] Apoe [−/−] mice showed reductions in plaque size and lipid content. [score:1]
We also tried to determine the contribution of the loss of miR-33 in recipient mice to atherosclerosis. [score:1]
A, Experimental protocol for the analysis of atherosclerosis in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Figure 1. miR-33 deficiency reduced atherosclerosis. [score:1]
Overall, these results demonstrate that a loss of miR-33 may have affected multiple pathways in both pro- and anti-inflammatory processes. [score:1]
Although a previous study demonstrated that the short-term administration of anti-miR-33 oligonucleotides raised HDL-C levels and promoted the regression of atherosclerosis, this current study indicates that miR-33 deficiency contributes to the reduction of plaque size in the progression of advanced atherosclerosis. [score:1]
ApoB -depleted serum from miR-33 [−/−] Apoe [−/−] mice significantly promoted cholesterol efflux in J774 macrophages (Figure 4E). [score:1]
In accordance with this in vitro experiment, apoptotic cells in the lesion area were also reduced in miR-33 [−/−] Apoe [−/−] mice. [score:1]
These data demonstrate that miR-33 deficiency serves to raise HDL-C, increase cholesterol efflux from macrophages via ABCA1 and ABCG1, and prevent the progression of atherosclerosis. [score:1]
[1 to 20 of 140 sentences]
10
[+] score: 126
In the present study, we predicted the potential miRNAs which might target at the 3′UTR of CCL2, and further identified miR-33 as a suppressor of CCL2 expression. [score:7]
miR-33 is a regulator of CCL2 expressionTo observe the regulatory role of miR-33 in CCL2 expression, we performed gain- or loss-of-function studies on miR-33 in primary chondrocytes. [score:7]
Figure 3miR-33 suppresses CCL2 expression via targeting at the 3′UTR(A) The schematic diagram of potential binding sites (79–98) for miR-33 in the 3′UTR of mouse CCL2 gene. [score:7]
miR-33 suppresses CCL2 expression via targeting at the 3′UTR. [score:7]
In the present study, we are the first to report the expression of miR-33 in mouse chondrocytes and identify CCL2 as its direct target. [score:6]
miR-33 suppresses CCL2 expression via targeting at the 3′UTRTo investigate the precise regulatory mechanism between miR-33 and CCL2, we subcloned the 3′UTR of mouse CCL2 gene into a miRNA reporter gene vector (Figure 3A). [score:6]
Those results indicated that miR-33 suppressed mouse CCL2 expression via a binding element locating at 79/98 in the 3′UTR. [score:5]
Those findings confirmed the suppressive role of miR-33 in CCL2 expression. [score:5]
Figure 1Prediction of potential miRNAs targeting at the 3′UTR of CCL2 gene(A and B) The potential target sites of miR-124 (A) or miR-33 (B) in the 3′UTR of CCL2 gene were conserved in human, mouse and rat species. [score:5]
Here in chondrocytes, we identified miR-33 as a regulator of CCL2 expression and monocyte chemotaxis. [score:4]
Figure 2 miR-33 is a regulator of CCL2 expression(A) The relative mRNA levels of CCL2 in the primary mouse chondrocytes transfected with a scramble miRNA (100 nM) or an anti-miRNA of miR-33 (100 nM) (n=4, ** P<0.01). [score:4]
To observe the regulatory role of miR-33 in CCL2 expression, we performed gain- or loss-of-function studies on miR-33 in primary chondrocytes. [score:4]
miR-33 is a regulator of CCL2 expression. [score:4]
Inhibition of miR-33 was conducted by transfecting the chondrocytes with an anti-miRNA of miR-33 (AM12410, Thermo Fisher Scientific). [score:3]
We demonstrated that the treatment with an anti-miRNA of miR-33 could strikingly induce the expression of CCL2 in the mRNA (Figure 2A) and protein (Figure 2B) levels as well as the secretion of CCL2 in the supernatant of cultured chondrocytes (Figure 2C). [score:3]
However, the role of miR-33 in CCL2 expression was still not clear. [score:3]
Further, we overexpressed miR-33 in chondrocytes by treating the cells with a miR-33 mimic (Figure 2D). [score:3]
As shown in Figure 4, we found that the CM from miR-33 mimic -treated chondrocytes significantly inhibited the migration rate of the monocytes, whereas the CM from anti- miR-33 -treated chondrocytes notably stimulated the monocyte chemotaxis. [score:3]
We found that the potential binding sites for miR-124 (Figure 1A) and miR-33 (Figure 1B) were conserved in multiple species, indicating that those two miRNAs might be functional in CCL2 suppression. [score:3]
Overexpression of miR-33 was carried out by transfecting the chondrocytes with a miR-33 mimic (MC12410, Thermo Fisher Scientific). [score:3]
As expected, we found that anti- miR-33 treatment largely potentiated the reporter gene activity (Figure 3B), whereas miR-33 mimic could significantly suppress the luciferase activity (Figure 3C). [score:3]
The miR-33/CCL2 axis in chondrocytes regulates the monocyte chemotaxisCCL2 is a potent attractor of monocytes [12]. [score:2]
Those findings indicated that miR-33/CCL2 axis in chondrocytes was functional in regulating monocyte chemotaxis. [score:2]
The miR-33/CCL2 axis plays an important role in regulating monocyte chemotaxis. [score:2]
Noteworthily, the anti- miR-33-stimulated reporter gene activity was abolished with the mutation of the potential miR-33 binding sites (Figure 3E). [score:2]
To further confirm the regulatory effect of miR-33 on CCL2 via the 3′UTR, the potential binding sites AAUGCA were mutated as ACCGAA (Figure 3D). [score:2]
The miR-33/CCL2 axis in chondrocytes regulates the monocyte chemotaxis. [score:2]
The miR-33/CCL2 axis might regulate monocyte chemotaxis in OA. [score:2]
To observe the regulatory role of miR-33/CCL2 axis in monocyte chemotaxis, transwell migration assays were carried out. [score:1]
To further correlate our in vitro findings to the physiopathological condition, we determined the levels of miR-33, CCL2, CD-68 and IL-1β in the cartilage of the patients with OA. [score:1]
These findings implied that the miR-33/CCL2 axis might not exist in macrophages or that the function of miR-33/CCL2 axis might be antagonized by other miR-33-initiated factors. [score:1]
In a previous study, miR-33 was reported to potentiate the pro-inflammatory activation of macrophages and aggravate the progression of atherosclerosis [31]. [score:1]
We presumed that the deficiency of miR-33 in the chondrocytes of OA patients would potentiate the production of CCL2, which then attracted the monocytes from peripheric blood to the articular tissues. [score:1]
Therefore, further studies on the role of miR-33/CCL2 axis in other cell types might be very interesting. [score:1]
Decreased miR-33 levels and elevated CCL2 levels in the cartilage of OA patientsTo further correlate our in vitro findings to the physiopathological condition, we determined the levels of miR-33, CCL2, CD-68 and IL-1β in the cartilage of the patients with OA. [score:1]
Therefore, our findings indicated a potential role of miR-33 in OA. [score:1]
miRNA-33 expression level was detected with the TaqMan microRNA assay real-time fluorescent quantitative PCR technology (TaqMan®MicroRNA Assays, Life Technologies). [score:1]
Then, the luciferase reporters (wt or mut) and miRNAs (miR-33 mimic, anti- miR-33 or scramble miRNA) were transfected using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen). [score:1]
The miR-33/CCL2 axis was identified in the primary mouse chondrocytes in the present study. [score:1]
Identical results were obtained in response to the treatment of miR-33 mimic (Figure 3F). [score:1]
Decreased miR-33 levels and elevated CCL2 levels in the cartilage of OA patients. [score:1]
Meanwhile, we demonstrated that the anti- miR-33 treatment -induced monocyte chemotaxis was prevented by supplementary CCL2 antibody. [score:1]
Figure 4The miR-33/CCL2 axis in chondrocytes regulates the monocyte chemotaxisThe primary chondrocytes were transfected with a scramble miRNA (100 nM), miR-33 mimic (100 nM) or anti- miR-33 (100 nM) for 36 h. Then, the supernatant was collected as CM for the chemotaxis test of monocytes in the transwell migration assays. [score:1]
We found that treatment of miR-33 mimic largely attenuated the mRNA (Figure 2E), protein (Figure 2F) and secretion (Figure 2G) levels of CCL2 in the chondrocytes. [score:1]
The previous and recent studies mainly focused the functions of miR-33 on the cholesterol homoeostasis [28, 29] and energy metabolism [30]. [score:1]
[1 to 20 of 45 sentences]
11
[+] score: 116
Other miRNAs from this paper: hsa-mir-33b
In contrast, it was shown that c-myc was negatively regulated by miR-33 at the post-transcriptional level, via a specific target site within the 3’UTR and over -expression of c-myc impaired miR-33b -induced inhibition of proliferation and invasion in osteosarcoma cells [16]. [score:8]
The expression of miR-33a was significantly up-regulated in HSCs directly cultured on feeder layer compare to that cultured without feeder layer. [score:7]
Although various reports indicated that miR-33 inhibits tumoral cell migration and invasion by targeting the c-myc gene, acting as a tumor suppressor. [score:7]
It seems that factors secreted by adipose stem cells in the feeder layer targeted mir-33 -mediated down-regulation of p53 in expansion of HSCs. [score:6]
Improvement in self-renewal of HSCs directly cultured on ADSCs was associated with increased expression of miR-33 and c-myc and decreased expression of p53. [score:6]
These results showed that high expression of miR-33a in the presence of ASCs feeder layer could down-regulate the p53 and enhance the expansion of HSCs. [score:6]
In this group, expression of miR-33a was higher than that in other groups Figure 7A) analysis of p53 and c-myc genes expression in fresh CD34+ cells by RT-PCR. [score:5]
On the other hand, it was reported that there is a negative relationship between miR-33 and c-myc so that over -expression of c-myc impaired miR-33b -induced inhibition of proliferation and invasion in osteosarcoma cells [16, 17]. [score:5]
Xu, et al, found that miR-33 Inhibits tumoral cell migration and invasion by targeting the c-myc gene, suppreses tumors. [score:5]
Based on the results of the present study, HSCs directly cultured on ADSCs presented higher levels of c-myc and miR-33a expressions than those in groups with indirect contact (ThinCert™ Plate). [score:5]
In this group expression of p53 was higher and miR-33a expression was lower than those of other groups. [score:5]
Our results showed that the expressions of miR-33a and p53 genes in ThinCert™ Plate with a pore size of 0.4 µm were lower than those of HSCs cultured directly on ASCs feeder layer. [score:4]
It has been shown that miR-33 family members modulate the expression of genes involved in cell cycle regulation and cell proliferation [13]. [score:4]
It seems that miR-33 mediated down-regulation of p53. [score:4]
RT-PCR analysis showed expression of miR-33a in groups where HSCs indirectly cultured on feeder layer and groups where HSCs cultured in the presence of the above-mentioned cytokines (Fig 6). [score:4]
Our results showed that expressions of miR-33a and p53 genes in ThinCert™ Plate with a pore size of 0.4 µm were lower than those in HSCs cultured directly on ASCs feeder layer. [score:4]
The findings of this study contributed to our understanding of the function of miR-33a in HSCs cultured on ADSCs, as a down-regulator of p53. [score:4]
On the other hand, another research showed that miR-33 reduces cell proliferation and cell cycle progression and impairing the p53 tumor suppressor gene function [23]. [score:3]
Figure 8A) Analysis of miR-33a expression in fresh CD34+ cells by RT-PCR. [score:3]
Perhaps, it explains that the expression level of miR-33 depends on the cell type. [score:3]
Various functions have been defined for miR-33 such as reduction of cell proliferation and cell cycle progression and impairing the p53 tumor suppressor gene function. [score:3]
Expression of genes p53, c-myc and miR-33 were analyzed by real-time PCR. [score:3]
Previously, it has been reported that miR-33 targets p53 [13]; p53 activates the transcription of genes that induce cell cycle arrest, apoptosis and senescence in response to several stress conditions including DNA damage [13]. [score:3]
Results showed that miR-33a and p53 negatively regulated each other. [score:2]
The function of miR-33 is associated with genes such as p53 and c-myc. [score:1]
To understand the effect of adipose-derived mesenchymal stem cells (ADSCs), as a feeder layer, on expansion of HSCs, the expression of p53 and miR-33a were evaluated. [score:1]
Defining the role of ADSCs in controlling the HSC self-renewal through miR-33, p53 and c-myc may lead to the treatment and prevention of hematopoietic disorders. [score:1]
Some studies have shown that miR-33, p53 and c-myc have critical roles in control of self-renewal cells. [score:1]
The sequences of GAPDH, p53 and c-myc are as follows: p53 Forward: 5’ TCCTCAGCATCTTATCCGAGTG 3’ Reverse: 5’ AGGACAGGCACAAACACGCACC 3’ c-myc Forward: 5’ CAAGAGGCGAACACACACAACGTCT 3’ Reverse: 5’ AACTGTTCTCGTCGTTTCCGCAA 3’ GAPDH Forward: 5’ ATGGGGAAGGTGAAGGTCG 3’ Reverse: 5’ GGGGTCATTGATGGCAACAATA 3’ miR-33a Forward: 5’ GTGCATTGTAGTTGCATTGCA 3’ Reverse: 5’ TGACCCCAGGTAACTCTGAGTG 3’ Real-time PCR Real-time PCR was performed with an Evagreen and data were analyzed using the formula 2-ΔΔct. [score:1]
Defining the role of ADSCs in controlling the HSCs self-renewal through increased miR-33 and reduced p53 may lead to the treatment and prevention of hematopoietic disorders. [score:1]
In conclusion, it seems that miR-33 increases proliferation of HSCs cultured on ADSCs by impairing the p53 function. [score:1]
[1 to 20 of 31 sentences]
12
[+] score: 97
miR-33a is downregulated in lung cancer cells and functions as a potent tumor suppressor, which decreases osteolytic bone metastasis via suppression of parathyroid hormone-related protein (42). [score:8]
miR-33a also functions as a tumor suppressor miRNA through its capacity to downregulate the expression of oncogenic kinase Pim-1 in K562 lymphoma and colon carcinoma (43, 44). [score:8]
The eight miRNAs selected included the most upregulated miRNAs (miR-512-3p, miR-377-5p, miR-433-3p and miR-1323) and most downregulated miRNAs (miR-33a-5p, miR-551b-3p, miR-3613-5p and miR-144-3p) in OS. [score:7]
miR-33a-5p demonstrated tumor suppressive abilities in vitro by inhibiting OS cell proliferation, which suggested that miR-33a-5p may have a tumor suppressor function in human OS. [score:7]
In the present study, miR-33a-5p was demonstrated to be downregulated in OS, while overexpression of miR-33a-5p by transfection, significantly attenuated OS cell growth in vitro. [score:6]
To verify the expression levels of miR-33a in OS, miR-33a-5p expression levels were determined in 32 paraffin-embedded human OS samples and 36 normal muscle tissues by TaqMan RT-qPCR. [score:5]
As shown in Fig. 2A, miR-33a-5p expression was significantly downregulated in paraffin-embedded OS tissues, compared with that of normal muscle tissue (P=0.0238). [score:5]
However, the mechanism by which miR-33a-5p is downregulated in OS remains to be elucidated. [score:4]
Among these miRNAs, miR-33a-5p is significantly downregulated in the majority of OS tissues. [score:4]
Subsequently, miR-33a-5p was further analyzed, as this was the most downregulated miRNA identified in the OS samples. [score:4]
miR-33 family members have been associated with modulation of the expression of various genes involved in cell cycle regulation and proliferation (45, 46). [score:4]
Among these, miR-512-3p, miR-377-5p, miR-433-3p and miR-1323 were the greatest upregulated miRNAs, whereas miR-33a-5p, miR-551b-3p, miR-3613-5p and miR-144-3p were the most decreased miRNAs in OS. [score:4]
miR-33 decreases cellular proliferation and cell cycle progression via inhibition of cyclin -dependent kinase 6 and cyclin D1 (45, 46). [score:3]
These results provide support for the rescue of miR-33a-5p expression via gene therapy, and demonstrated the potential use of miR-33a-5p as diagnostic marker or therapeutic tool for the treatment of human OS. [score:3]
miR-33a-5p inhibits OS cell proliferation. [score:3]
miR-33a-5p has recently emerged as a key regulator of metabolism, and was shown to regulate cholesterol and lipid metabolism (40, 41). [score:3]
miR-33a-5p expression is decreased in paraffin-embedded OS samples. [score:3]
These results indicated that the miR-33a-5p precursor was able to effectively increase miR-33a-5p expression in U2-OS and MG-63 cells. [score:3]
miR-33a-5p expression in OS samples and normal bone or muscle tissues were compared using the Mann-Whitney U test. [score:2]
Following 48, 72 and 96 h of incubation, U2-OS and MG-63 cells overexpressing miR-33a-5p exhibited decreased cell proliferation, as compared with miR-Scramble -transfected cells, respectively (P<0.05; Fig. 3A). [score:2]
The results demonstrated that miR-33a-5p mimic enhanced miR-33a-5p expression by ~152-fold (P<0.001) in U2-OS cells and ~341-fold in MG-63 cells (P<0.001), compared with the scramble -transfected group (Fig. 2B). [score:2]
The miR-33a-5p precursor and random sequence CY3-labeled miR-Scramble were synthesized by Ambion. [score:1]
Specifically, miR-33a-5p was decreased most in OS, which suggested that miR-33a-5p may have a role in the pathogenesis of OS. [score:1]
These results suggested that miR-33a-5p may have a role in the pathogenesis of OS. [score:1]
To the best of our knowledge, the role of miR-33a-5p in OS has not previously been reported. [score:1]
miR-33a-5p precursor transfection. [score:1]
U2-OS and MG-63 cells were counted and plated at a density of 4×10 [5] cells/well in 6-well plates for overnight incubation prior to transfection with 100 nM miR-33a-5p precursor or miR-Scramble using Lipofectamine® 2000 (Invitrogen Life Technologies, CA, USA) according to the manufacturer's instructions. [score:1]
Additionally, 24 h post transfection, miR-33a-5p expression levels were evaluated by RT-qPCR. [score:1]
[1 to 20 of 28 sentences]
13
[+] score: 96
A recent article reports that overexpression of miR-33a or miR-33b induces a significant G1 arrest in cancer cell lines through targeting the cyclin -dependent kinase 6 (CDK6) and cyclin D1 (CCND1) genes (Cirera-Salinas et al, 2012), supporting that the miR-33 family is a regulator of cell cycle progression both directly (targeting CDK6 and CCND1) and indirectly (targeting c-Myc to reduce cyclin E expression). [score:14]
c-Myc and its transcriptional targets, cyclin E and ODC, are down-regulated by miR-33b, but not miR-33a or miR-33bM, while GADD45α is up-regulated. [score:9]
Furthermore, miR-33a, a homolog of miR-33b, was recently found to be upregulated by metformin to inhibit c-Myc expression in breast cancer cells and mouse xenografts. [score:8]
A new article reports that miR-33a is upregulated by metformin to inhibit c-Myc expression in breast cancer cells and mouse xenografts; interestingly, this is mediated by elevated levels of DICER (Blandino et al, 2012). [score:8]
At minimum, the expression of both miR-33a and SREBF1 is upregulated by lovastatin (Fig 4): miR-33a may enhance the function of miR-33b since they share target genes (Horie et al, 2010; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010) and the SREBF1 gene is implied to be pro-apoptotic (Gibot et al, 2009). [score:8]
It should be noted that there are genes other than MYC negatively regulated by miR-33 and that lovastatin, like any other drug, impacts the expression of numerous genes beyond inhibiting HMG-CoA reductase. [score:6]
Lovastatin also slightly induced miR-33a expression but did not change MYC mRNA levels and mevalonate inhibited miR-33a induction in D283 cells (Fig 4G and H). [score:5]
It is noteworthy that c-Myc expression was down-regulated by miR-33b, but not miR-33a, which differs from miR-33b by only two nucleotides (UA compared with CG) in the middle of their mature sequences (Fig 1H). [score:5]
Our miR-33a construct did not inhibit c-Myc expression, most likely due to insufficient precursor processing (Supporting Information Fig S2A). [score:5]
When the miR-33b and miR-33a minigenes were introduced into 293T cells, miR-33b was overexpressed ∼25-fold, while miR-33a was overexpressed approximately fivefold. [score:5]
Mevalonate inhibits lovastatin -induced miR-33b and miR-33a expression. [score:5]
We suggest that miR-33 upregulation and subsequent c-Myc attenuation are critical to the anti-neoplasia action of these potential cancer prevention and treatment agents. [score:4]
Correspondingly, introduction of miR-33b, but not miR-33a or miR-33bM, reduced the protein levels of c-Myc, as well as two known c-Myc transactivational targets, cyclin E and ornithine decarboxylase (ODC). [score:3]
Abca1 and Pim1 are two reported miR-33 target genes (Horie et al, 2010; Ibrahim et al, 2011; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010; Thomas et al, 2012). [score:3]
We performed Assay 1 in 293T cells using hundreds of miRNA minigenes in our genetic library (Lu et al, 2011) and found that 4 miRNAs (miR-33a, miR-33b, miR-212 and miR-203) significantly down-regulated the c-Myc -dependent reporter (Fig 1B; Supporting Information Fig S1A). [score:3]
Schematic representation of the binding of miR-33b, a miR-33b mutant (miR-33bM), or miR-33a to the MYC 3′UTR. [score:1]
We constructed a mutant miR-33b (miR-33bM) minigene with a mature sequence the same as miR-33a and a precursor similar to pre-miR-33a. [score:1]
It is likely the less stable pre-miR-33a leads to lower levels of mature miR-33a, which is supported by the finding that disruption of the stem of pre-miRNAs significantly reduces the efficiency of miRNA maturation (Han et al, 2006). [score:1]
Therefore, activation of the transcription or enhanced processing of miR-33 to constrain the oncogenic activities of c-Myc represents one of the potential anti-cancer properties of statins or metformin. [score:1]
We folded the precursors of miR-33b and miR-33a (Zuker, 2003) and found the structure of pre-miR-33b was more stable than that of pre-miR-33a (Supporting Information Fig S2A). [score:1]
[1 to 20 of 20 sentences]
14
[+] score: 86
Other miRNAs from this paper: mmu-mir-33, hsa-mir-33b
Because Srebf1 level is higher in the liver than that in macrophages 22, it is possible that miR-33b and miR-33a compete for the same target gene binding sites in the liver, and that the degradation of miR-33a is inhibited by miR-33b expression. [score:7]
This needs to be kept in mind when attempting to directly translate to humans the previous results that miR-33a inhibition could prevent atherosclerosis in mouse mo dels because of two reasons. [score:6]
Second, miR-33b differs from miR-33a by 2-nucleotides and may have a different target profile, including stronger effects on targets in the SREBP-1 -dependent regulation of fatty acid/TG homeostasis and insulin signaling. [score:6]
However, it is known that one miR can have hundreds of target genes and unexpected side effects may occur due to long-term therapeutic modulation of miR-33 to cure metabolic diseases. [score:5]
Because miR-33b is located in a SREBF1 intron in humans (Supplementary Fig. S1a), we stimulated human cell line HepG2 with the LXR agonist T0901317 and determined miR-33b and miR-33a expression along with the expression of the host genes SREBF1 and SREBF2. [score:5]
Moreover, the protein levels of previously defined miR-33a target genes, which were not dysregulated in miR-33a KO mice, including CPT1a and AMPKα, remained unchanged 19 20. [score:4]
Although there were no differences in the levels of miR-33a in macrophages, it is interesting that the levels of miR-33a were increased in proportion to the expression levels of miR-33b in the liver. [score:3]
Although there was no difference in miR-33a levels in macrophages (Supplementary Figure S3b), miR-33a levels were increased in proportion of the expression levels of miR-33b in the liver (Supplementary Figure S2b). [score:3]
However, the protein levels of miR-33a target genes, such as ABCA1, ABCG1, and SREBP-1, were reduced 18. [score:3]
The protein levels of known miR-33a/b target genes, such as ABCA1, ABCG1, and SREBP-1, were reduced under basal conditions. [score:3]
Careful observations of miR-33b KI and miR-33a -deficient mice and intercrossing of these mice will enable us to detect miR-33a- and miR-33b-specific target genes and to elucidate the overall functions of miR-33a and miR-33b in vivo. [score:3]
However, Rottiers et al. did not find any significant changes in TG levels when using miR-33a/b -targeting LNA-anti-miR treatment 24. [score:3]
Our data demonstrated that miR-33b indeed functions to control HDL-C levels, which highlights the importance of targeting both miR-33 family members simultaneously. [score:3]
However, the protein levels of some of the previously defined miR-33a target genes, such as CPT1a and AMPKα remained unchanged. [score:3]
miR-33b KI results in alterations in miR-33a target proteins ABCA1 and SREBP-1. miR-33b KI reduces cholesterol efflux in macrophages. [score:3]
More recently, Rottiers et al. reported that miR-33a and miR-33b acted in a redundant manner and that inhibiting both isoforms by an 8-mer LNA -modified anti-miR enhanced HDL-C levels 24. [score:3]
Rayner et al. recently showed that inhibiting miR-33a and miR-33b in healthy male non-human primates increased circulating HDL-C levels 21. [score:3]
The relative expressions of SREBF1 (a), miR-33b (b), SREBF2 (c), and miR-33a (d) are shown (n = 6–9). [score:3]
We assume that inhibiting both miR-33a and miR-33b will have a significant effect on HDL-C levels in clinical settings. [score:3]
Moreover, our mice will aid in analyzing the roles of miR-33a/b in different genetic disease mo dels and in screening drug candidates that can modulate miR-33a and miR-33b levels and activities. [score:3]
In contrast, miR-33a and SREBF2 expression was not affected by LXR stimulation (Fig. 1c and d). [score:3]
This indicates that both isoforms of miR-33 participate in regulating the primary risk factors of metabolic syndrome, which accelerate atherosclerosis. [score:2]
In addition to the effects on HDL-C, a study by Rayner et al. showed that miR-33 antagonism reduced very low-density lipoprotein -associated TGs in their cohort of normal male African green monkeys 21. [score:1]
Moreover, we previously reported that the miR-33a [−/−] mice had 22%–39% higher serum HDL-C levels than the WT mice 8. Thus, we determined the serum HDL-C levels of the WT, miR-33b KI [+/−], and miR-33b KI [+/+] mice at the age of 8 weeks. [score:1]
ABCA1 and ABCG1 protein levels were lower in macrophages from the miR-33b KI [+/+] mice than from the WT mice (Fig. 5a and Supplementary Figure S3e and S3f), which was compatible with the findings for our miR-33a -deficient mice. [score:1]
In contrast to humans and other mammals, rodents lack miR-33b and only have miR-33a in Srebf2. [score:1]
In this context, the current LNA -modified anti-miR technique is quite potent for reducing the levels of both miR-33 isoforms and may be useful for anti-atherosclerosis therapy. [score:1]
In any event, the numbers of miR-33b transcripts were greater than those of miR-33a transcripts, and this underscores the importance of miR-33b 21. [score:1]
[1 to 20 of 28 sentences]
15
[+] score: 82
Conversely, antagonism miR-33 upregulates ABCA1 expression in vitro and in vivo and promotes cholesterol efflux to ApoA-I. Importantly, in vivo inhibition of miR-33 expression leads to a significant increase in plasma HDL levels and the regression of atherosclerosis, thus confirming the physiological effects of miR-33 in regulating lipid metabolism [12, 25, 68, 69]. [score:11]
Altogether, these data suggest that the inhibition of miR-33 expression may be a promising strategy to treat atherosclerotic vascular disease, metabolic syndrome, and liver regeneration in chronic liver disease. [score:9]
To assess whether anti-miRNA-33 therapy increases liver ABCA1 expression and plasma HDL levels, several groups silenced miR-33 expression using a variety of strategies including modified oligonucleotides and antisense oligonucleotides expressed in lentiviral or adenoviral constructs. [score:7]
miR-33 overexpression strongly represses ABCA1 expression at the RNA and protein level and decreases cellular cholesterol efflux to apolipor protein A-I (ApoA-I), a key step in regulating reverse cholesterol transport (RCT). [score:6]
Interestingly, miR-33 is highly expressed in the brain, and many predicted targets for miR-33 are involved in neurogenesis, such as Sema-3a and netrin-1, and synaptic regulation, including glutamate receptor ionotropic Kainate 2 (GRIK2) and glutamate receptor ionotropic AMPA 3 (AMPA 3). [score:6]
Another interesting difference between humans and rodents is that the 3′UTR of Npc1 in humans contains two miR-33 binding sites resulting in a significant repression of NPC1 protein expression, whereas mice only contain one site, which is modestly suppressed by miR-33 [12]. [score:5]
Moreover, miR-33a and miR-33b also target the insulin receptor substrate 2 (IRS2), an essential component of the insulin-signaling pathway in the liver [72]. [score:3]
C. Fernández-Hernando has patents on the use of miRNA-33 inhibitors. [score:3]
In addition to ABCA1, two important genes involved in cholesterol metabolism were described as targets of miR-33: ABCG1 which mobilizes cellular free cholesterol to more lipidated HDL particles, and Niemann Pick C1 (NPC1), which transports cholesterol from lysosomes to other cellular compartments. [score:3]
Although the preclinical studies of miR-33 inhibition in mice are encouraging, extrapolation of these findings to human is complicated by the fact that mice lack miR-33b. [score:3]
As expected, mice treated with anti-miR-33 oligonucleotides have a significant increase in liver ABCA1 expression and plasma HDL levels. [score:3]
In addition to the role of miR-33 in regulating cholesterol and fatty acid metabolism, we have also recently shown that miR-33 regulates cell cycle progression and cellular proliferation [73]. [score:3]
Furthermore, this study also shows that in vivo inhibition of miR-33 using antisense oligonucleotides improves liver regeneration after partial hepatectomy [73]. [score:3]
miR-33a and miR-33b also target genes involved in the β-oxidation of fatty acids, including carnitine palmitoyltransferase 1A (CPT1A), carnitine O-octanoyltransferase (CROT), hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (HADHB), 5′ adenosine monophosphate-activated protein kinase (AMPK), and sirtuin 6 (SIRT6). [score:3]
mir-33a and mir-33b are co-transcribed with their host genes and regulate cholesterol and fatty acid metabolism. [score:2]
Several miRNAs have been described to regulate lipid metabolism, including miR-122, miR-33, miR-758, and miR-106b [11– 14] (Table 1). [score:2]
miR-33 negatively regulates cyclin -dependent kinase 6 (CDK6) and cyclin D1 (CCND1), which results in cell cycle arrest in G1 phase. [score:2]
Interestingly, Abcg1 has two miR-33 binding sites in its 3′UTR that are only present in rodents, suggesting that cellular efflux to mature HDL is differently regulated between species [12, 24]. [score:2]
These results were later confirmed genetically in the miR-33 knockout mice. [score:2]
The data summarized in this paper pointed out that anti-miR-33, miR-758 therapy, and miR-106 may be useful for treating dyslipidemia and cardiovascular disorders. [score:1]
Nevertheless, anti-miR-33 therapy in nonhuman primates has demonstrated to be very effective in increasing the levels of HDL and reducing VLDL [71]. [score:1]
MiR-33: A Key Regulator of Lipid Metabolism. [score:1]
We and others have recently identified miR-33a and miR-33b, intronic miRNAs located within the Serbp2 and Srebp1 genes, respectively [12, 24, 25]. [score:1]
[1 to 20 of 23 sentences]
16
[+] score: 76
Mao et al. [21] recently demonstrated that miR-33 expression can be upregulated in human THP-1 monocytes by inflammation, leading to a decrease in ABCA1 expression and cholesterol efflux. [score:8]
Pitavastatin has also been shown to regulate VCAM-1 through miR-126 in endothelial cells [10]; and, others have demonstrated that several statins increase miR33 expression, and decrease ABCA1 expression and cholesterol efflux in macrophage cell lines [10, 11]. [score:6]
Because expression levels of miR-33a and miR-33b were altered significantly after 16 hours treatment of oxLDL, we questioned whether miR-33 expression also is changed at other time points. [score:5]
Moreover, we searched potential targets for miR-33 and miR-758 using the Targetscan (http://www. [score:5]
In a pattern similar to miR-33, miR-758 expression was suppressed by oxLDL. [score:5]
Based on our findings and the existing literature, it is unlikely that miR-33 is solely responsible for regulating of ABCA1 and other RCT proteins, as the slight increase in miR-33 cannot rationally explain the robust suppressive effect on ABCA1 by pitavastatin (Fig 3). [score:4]
Predicted targets for miR-33 and miR-758. [score:3]
Importantly, pitavastatin prevented the suppression of miR-33a, miR33b, and miR-758 by oxLDL (Fig 1). [score:3]
Our new findings presented herein provide evidence that pitavastatin can alter the capacity of oxLDL to suppress miR-33a, -33b, and -758 miRNAs in THP-1 cells. [score:3]
Expression of miR-33a, -33b, -758 and SREBP-2 in THP-1 macrophages. [score:3]
Expression of miR-33a, miR-33b and miR-758 displayed significant reduction from 8 to 16 hours (S1 Fig). [score:3]
Having shown that miRNAs with an established link to cholesterol homeostasis (miR-33 and miR-758) are differentially targeted by pitavastatin in the presence and absence of oxLDL, we set out to define if a broader network of miRNAs is similarly modulated. [score:3]
miR-33 and -758 have been specifically shown to negatively regulate ABCA1 in macrophages [2, 4]. [score:2]
The impact of statins in regulating miR-33 and -758 under basal conditions appear to be modest, however this pathway becomes amplified in a pro-atherogenic milieu when oxLDL is present. [score:2]
0159130.g002 Fig 2 (A) This regulator of cholesterol metabolic genes and known to harbor miR-33a and -33b, was examined in THP-1 macrophages by real time RT-PCR. [score:2]
Regulation of miR-33 and -758 by pitavastatin in the presence and absence of oxLDL. [score:2]
Sterol regulatory element binding protein (SREBP) is a lipogenic transcription factor; and, miR-33a and miR-33b are intronic miRNAs within SREBP. [score:2]
Expression of miR-33a, -33b and -758 in THP-1 macrophages were measured by real time RT-PCR. [score:1]
Pitavastatin alone led to a modest increase in miR-33a and a modest decrease in miR-33b in the control group, neither of which reached statistical significance. [score:1]
As shown in Fig 1, oxLDL elicited a significant reduction in both miR-33a and -33b mRNA after 16 hours treatment. [score:1]
miR-33a and -33b have been demonstrated to physiologically impact the fine-tuning of cholesterol efflux in the liver, primarily through ABCA1 [3]. [score:1]
In humans, miR-33a and -33b are encoded in the introns of SREBF-2 and SREBF-1, the former of which encodes for SREBP-2, and is critical to cholesterol homeostasis. [score:1]
Furthermore, the genetic deletion of miR-33 in mice increases plasma HDL-C levels and reduces the progression of atherosclerosis [4]. [score:1]
The increase in miR-33 has been linked to induction of SREBP-2 [18]. [score:1]
Previous reports have shown that atorvastatin and simvastatin induce miR33a mRNA in unloaded cells, and to a lesser degree, in cholesterol -loaded cells [17]. [score:1]
However, pitavastatin prevented the decreases in miR-33a and in miRNA33b seen in the oxLDL-alone group. [score:1]
While the present study focused on the effect of pitavastatin, the effects of other statins on miR-33 and ABCA1 have been shown consistent enough to postulate a similar response profile across the class [3, 17]. [score:1]
Although we observed a clear induction of SREBP mRNA and protein by pitavastatin (Fig 2), they were not accompanied by an equally notable increase in miR-33. [score:1]
Therefore, the elevated levels of miR-33 may not be necessarily attributed to SREBP-2. At this time, the mechanism of these findings remains unclear. [score:1]
0159130.g001 Fig 1 Expression of miR-33a, -33b and -758 in THP-1 macrophages were measured by real time RT-PCR. [score:1]
Under baseline conditions, we observed that oxLDL decreased miR-33a, miR33b, and miR-758. [score:1]
miR-33a and miR-33b were the first reported miRNAs to be linked to ABCA1 [2]. [score:1]
[1 to 20 of 32 sentences]
17
[+] score: 76
Other miRNAs from this paper: hsa-mir-130a, hsa-mir-155, hsa-mir-130b, hsa-mir-33b
In contrast, MafB is directly targetable and down-regulated by pro-inflammatory and pro-atherogenic microRNAs, miR-155 and miR-33, which have been shown to be significantly up-regulated in atherosclerotic plaque [7]. [score:10]
miR-33, an intronic microRNA located within the SREBF2 gene, has been shown to target and suppress Abca1 expression in human and mouse macrophages, and thereby attenuate reverse cholesterol transport and promote atherosclerotic development [33]. [score:8]
However, a non-targetable mutation of the candidate miR-33 target sequence blocked the inhibitory effect of miR-33. [score:8]
These findings suggest that the increase in MafB expression may be attributed largely to reduced extent of miR-33 -mediated inhibition, further supporting the notion that MafB may also be a direct target of miR-33 in these animals. [score:8]
In contrast, MafB is directly targeted and down-regulated by pro-inflammatory and pro-atherogenic microRNAs, miR-155 and miR-33. [score:7]
Further, ectopic expression of miR-33 in THP-1 cells significantly reduced the endogenous MafB mRNA (Fig.   6c), indicating that human MafB mRNA is a direct target of miR-33. [score:6]
However, the same treatments did not enhance expression of c-Maf and aforementioned potential positive regulators of MafB that do not contain candidate miR-33 target sequence in their 3′ UTRs. [score:6]
Notably, we found that this pro-atherogenic miR-33 could directly target the 3′ UTR of MafB mRNA in human (Fig.   6e), although candidate miR-33 target sequence was not fully conserved in mouse. [score:6]
Notably, analyses of publically available high-throughput datasets revealed that in two separate studies of african green monkeys 34, 35, in vivo administration of anti-miR-33 significantly increased hepatic expression of MafB (Supplementary Figs.   S6 and S7), as well as a known miR-33 target, Abca1, despite A to G substitution in the miR-33 seed region of MafB 3′ UTR in these animals (Fig.   6e). [score:5]
Notably, MafB, but not c-Maf, is directly targetable and negatively regulated by pro-atherogenic miR-33 (Fig.   6f). [score:5]
Accordingly, ectopic miR-33 expression in 293ETN cells significantly reduced the activity of the MafB 3′ UTR reporter, to an extent equivalent to an ABCA1 3′ UTR reporter (Fig.   6f). [score:3]
Figure 6Atherogenic miR-155 and miR-33 negatively regulate MafB. [score:2]
Atherogenic miR-155 and miR-33 negatively regulate MafB. [score:2]
[1 to 20 of 13 sentences]
18
[+] score: 71
In vivo, mRNA expression of these proteins were reduced following miR-33a overexpression, while miR-33a inhibition increased BSEP and ATP8B1 expression [66]. [score:9]
Statins are known to increase SREBP2 and miR-33-5p expression [68], therefore, individuals taking statins will likely have consistently low levels of miR-33-5p target genes, including those involved in bile acid export, which may lead to increased hepatic cholesterol accumulation, a known side effect of statins. [score:5]
In vitro work suggests that miR-33b-3p regulates ABCA1 indirectly, via Sp1 [6], while miR-33a-3p also regulates ABCA1 indirectly via the transcription factor steroid receptor coactivator 1 (SRC1). [score:5]
Indeed, multiple groups have shown that miR-33-5p and miR-144-5p have an additive effect on suppression of ABCA1 [54, 60, 62], while cotransfection of miR-33-5p and miR-758 further reduced ABCA1 expression in vitro [48]. [score:5]
Gerin I. Clerbaux L. A. Haumont O. Lanthier N. Das A. K. Burant C. F. Leclercq I. A. MacDougald O. A. Bommer G. T. Expression of miR-33 from an SREBP2 intron inhibits cholesterol export and fatty acid oxidation J. Biol. [score:5]
Inhibition of miR-33 increased hepatic ABCA1 expression, plasma ApoA1 and HDL, and RCT, and decreased aortic plaque size, lesion macrophage and lipid content, and macrophage cholesterol efflux [55, 56, 57]. [score:5]
MiR-33a overexpression in vitro reduced expression of cholesterol 7α hydroxylase (CYP7A1), sterol 12α hydroxylase (CYP8B1), sodium-taurocholate cotransporting polypeptide (NTCP), bile salt export pump (BSEP), ATP binding cassette transporter G5 (ABCG5), and ATP binding cassette transporter G8 (ABCG8), all of which are involved in the synthesis and secretion of bile acids in the liver [66]. [score:4]
Horie T. Nishino T. Baba O. Kuwabara Y. Nakao T. Nishiga M. Usami S. Izuhara M. Sowa N. Yahagi N. MicroRNA-33 regulates sterol regulatory element -binding protein 1 expression in mice Nat. [score:4]
It is possible that this could have clinical implications in which a combination of statin therapy and miR-33-5p inhibition would alleviate the hepatotoxic side effects of the drug. [score:3]
Moreover, increased bile acid production in vivo triggered SREBP2 and miR-33a expression to promote cholesterol synthesis and reduce CYP7A1, respectively [66]. [score:3]
These results highlight the potential of miR-33 or miR-302a suppression as a strategy to promote RCT and the regression of atherosclerosis [51, 55]. [score:3]
Two groups recently showed that miR-33a, in addition to the previously discussed roles in regulation of cholesterol homeostasis, is also involved in regulation of bile acid metabolism [66, 67]. [score:3]
Interestingly, ABCG1 is a target of miR-33-5p in mice but not humans [65]. [score:3]
MiR-33-5p and its passenger strand, miR-33-3p, also have an additive effect on expression of ABCA1 [6]. [score:3]
However, co-treatment of cells with miR-33-5p and miR-145 did not have an additive effect on ABCA1 expression [50]. [score:3]
Along with miR-33-5p, miR-223 is involved in the regulation of numerous genes that maintain cholesterol homeostasis. [score:2]
Niesor E. J. Schwartz G. G. Perez A. Stauffer A. Durrwell A. Bucklar-Suchankova G. Benghozi R. Abt M. Kallend D. Statin-Induced decrease in ATP -binding cassette transporter A1 expression via microRNA33 induction may counteract cholesterol efflux to high-density lipoprotein Cardiovasc. [score:2]
Allen R. M. Marquart T. J. Albert C. J. Suchy F. J. Wang D. Q. H. Ananthanarayanan M. Ford D. A. Baldán Á. MiR-33 controls the expression of biliary transporters, and mediates statin- and diet -induced hepatotoxicity EMBO Mol. [score:2]
Tarling E. J. Ahn H. de Aguiar Vallim T. Q. The nuclear receptor FXR uncouples the actions of miR-33 from SREBP-2 Arterioscler. [score:1]
Rayner K. J. Sheedy F. J. Esau C. C. Hussain F. N. Temel R. E. Parathath S. van Gils J. M. Rayner A. J. Chang A. N. Suarez Y. Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis J. Clin. [score:1]
[1 to 20 of 20 sentences]
19
[+] score: 63
These findings demonstrate for the first time the utility of seed -targetings in pharmacological inhibition of an entire miRNA family in non-human primates and imply that even under conditions of obesity, hyperglycemia and low insulin responsiveness in a severe metabolic disease animal mo del, inhibition of the miR-33 family is a feasible approach to increase circulating HDL cholesterol (Rottiers et al, 2013). [score:9]
Recently, Rottiers et al (2013) reported on pharmacological inhibition of the miR-33 family using a subcutaneously injected, seed -targeting 8-mer LNA -modified in a non-human primate metabolic disease mo del. [score:7]
In addition, pharmacological inhibition of miR-33a/b led to derepression of several miR-33 targets implicated in fatty acid oxidation and a decrease in very-low-density lipoprotein (VLDL) triglycerides, without any evidence for adverse effects in the treated monkeys (Rayner et al, 2011b). [score:5]
Nevertheless, the different outcomes described above raise concerns with regard to translating pharmacology data from miR-33 inhibition studies in mouse mo dels to human therapy and highlight the need of additional long-term studies in larger animals, which in contrast to mice, harbor both miR-33 isoforms. [score:5]
Horie et al (2012) showed that genetic loss of miR-33 in apolipoprotein E -deficient (Apoe [−/−]) knockout mice enhanced cholesterol efflux and significantly reduced atherosclerotic plaque size and lipid content, whereas Rotllan et al (2013) reported that long-term inhibition of miR-33 in Ldlr [−/−] knockout mice fed a Western diet significantly reduced the progression of atherosclerosis. [score:5]
In this study, treatment of obese and insulin-resistant female African green monkeys with the 8-mer over 108 days resulted in derepression of direct miR-33 targets, including ABCA1, increased circulating HDL cholesterol and was well tolerated without any adverse effects. [score:4]
The miR-33a and miR-33b sequences share the same seed region and are thus predicted to regulate an overlapping set of target mRNAs, indicating that they may have redundant biological functions. [score:4]
Notably, inhibition of miR-33 by a subcutaneously delivered 2′F/MOE -modified for 4 weeks in hyperlipidemic low-density lipoprotein receptor (Ldlr [−/−]) knockout mice fed a standard chow diet enhanced reverse cholesterol transport and showed atherosclerotic plaque regression, consistent with accumulation of the-33 in plaque macrophages (Rayner et al, 2011a). [score:4]
A number of recent reports have shown that the human sterol-regulatory-element -binding-protein genes SREBF1 and SREBF2 harbor two intronic miRNAs, miR-33b and miR-33a, respectively, which regulate cholesterol, fatty acid and triglyceride homeostasis in concert with their host gene products, SREBP1 and SREBP2 (Gerin et al, 2010; Horie et al, 2010; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010, 2011a). [score:3]
Indeed, two studies have reported on pharmacological inhibition of miR-33 in non-human primates. [score:3]
Rayner et al (2011b) showed that treatment of normal male African green monkeys by a subcutaneously delivered 2′F/MOE -modified targeting both miR-33a and miR-33b resulted in derepression of hepatic ABCA1 levels and sustained increase in plasma HDL cholesterol over 12 weeks (Rayner et al, 2011b). [score:3]
Targeting of miR-33 for the treatment of atherosclerosis. [score:3]
By comparison, a third study by Marquart et al (2013) reported that long-term inhibition of miR-33 in high-fat-/high-cholesterol-fed Ldlr [−/−] mice failed to sustain elevated HDL cholesterol levels in the serum and did not alter progression of atherosclerosis, despite initial increase in HDL cholesterol after 2 weeks of treatment (Marquart et al, 2013). [score:3]
Several studies have shown that genetic deletion or -mediated inhibition of miR-33 in mice leads to derepression of hepatic ABCA1 and increase in circulating HDL cholesterol levels by up to 40%, suggesting that silencing of miR-33 could be a useful therapeutic strategy for atherosclerosis (Horie et al, 2010; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010, 2011a). [score:3]
The miR-33a/b family plays an important role in post-transcriptional repression of the ATP -binding cassette transporter ABCA1, which is essential for high-density lipoprotein (HDL) biogenesis and promotes reverse cholesterol transport from peripheral tissues, such as atherogenic macrophages, back to the liver (Rottiers & Näär, 2012). [score:1]
Interestingly, mice and other rodents have only one miR-33 isoform in intron 16 of SREBF2, corresponding to miR-33a in humans and non-human primates (Rottiers & Näär, 2012). [score:1]
[1 to 20 of 16 sentences]
20
[+] score: 46
Other miRNAs from this paper: hsa-mir-30d, hsa-mir-125b-1, hsa-mir-125b-2, hsa-mir-33b
In our study, we found that AR-42 upregulated miR-30d, miR-33, and miR-125b in both BxPC-3 (Fig 4C) and PANC-1 (Fig 4D) cells, which suggested that AR-42 suppresses p53 expression by inducing the expression of several p53 -targeting miRNAs. [score:12]
Meanwhile, according to our results, AR-42 upregulated expression levels of three miRNA, miR-30d, miR-33, and miR-125b (Fig 4C and 4D), which have been previously shown to inhibit p53 gene expression. [score:10]
MiR-33 inhibited expression of Cdk6 and cyclin D1 in liver cells [55], and we demonstrated that AR-42 decreased mRNA expression of cyclin B2 and cdc25B, suggesting that miR-33 might be involved in AR-42 -mediated cell cycle regulation. [score:8]
In addition, AR-42 increased expression levels of negative regulators of p53 (miR-125b, miR-30d, and miR33), which could contribute to lower expression level of mutant p53 in pancreatic cancer cells. [score:6]
Expression levels of miR-30d, miR-33, and miR-125b were determined by real-time PCR of AR-42 treated BxPC-3 (C) and PANC-1 (D) cells for 24, 48 and 72 h. Expression levels of miRNAs were normalized by that of the reference gene U6. [score:5]
MicroRNA-30d (miR-30d), miR-33, and miR-125b have been shown to inhibit p53 mRNA expression [27]. [score:5]
[1 to 20 of 6 sentences]
21
[+] score: 36
Gerin I. Clerbaux L. A. Haumont O. Lanthier N. Das A. K. Burant C. F. Leclercq I. A. MacDougald O. A. Bommer G. T. Expression of mir-33 from an srebp2 intron inhibits cholesterol export and fatty acid oxidation J. Biol. [score:5]
They suggested that the anticancer metabolic effects induced by metformin in breast cancer cell lines were, also a direct consequence of the Myc inhibition mediated by the up regulation of miR-33a. [score:5]
In addition, the inhibition of the endogenous levels of miR33 in human liver cells induces fatty acid degradation, through the lack of modulation in the expression of genes involved in the oxidation of fatty acid [56, 57]. [score:5]
The inhibition of ABCA1 by miR-33 induced an efflux of cholesterol from peripheral tissues to the liver and a consequent reduction of circulating high-density lipoprotein-cholesterol (HDL-C) [53]. [score:3]
Similar to the miR-122 family of microRNAs, miR-33 is implicated as a potential target for metabolic disorders treatment. [score:3]
miR-33 -targeting antisense oligonucletotides appears to be a novel therapy approach for cardio metabolic disorders, such as atherosclerosis. [score:3]
However, Blandino and colleagues have shown in breast cancer cell lines a direct interaction between the miR-33a and the 3′-utr region of Myc mRNA. [score:2]
Davalos A. Goedeke L. Smibert P. Ramirez C. M. Warrier N. P. Andreo U. Cirera-Salinas D. Rayner K. Suresh U. Pastor-Pareja J. C. Mir-33a/b contribute to the regulation of fatty acid metabolism and insulin signaling Proc. [score:2]
miR-33a and miR-33b are intronic microRNAs which are encoded together with their host genes, the sterol-regulatory element -binding proetein 1 (Srebp1) and 2 (Srebp2). [score:2]
In particular, Srebp2 and its intronic microRNA, miR-33a, regulate the cholesterol homeoastasis by modulating transcriptionally and post-transcriptionally the activity of genes involved in the cellular cholesterol export, such as the ATP -binding cassette (ABC) transporter ABCA1 and ABCG1 [53, 54, 55]. [score:2]
Moreover, miR-33 have been involved in the post-transcriptional modulation of other mRNAs involved in the regulation of lipid and glucose metabolism, such as the α1 subunit of AMP-activated protein kinase (AMPKα1) [56, 58, 59]. [score:2]
However, there is not a specific separation of function between miR-33a and miR-33b. [score:1]
Several studies confirmed this evidence; thus, there is an extensive collaboration between miR-33a and miR-33b and their host genes (Figure 1). [score:1]
[1 to 20 of 13 sentences]
22
[+] score: 36
Using a stringent cutoff of a match score between each miRNA and its mRNA targets followed by analysis for unique mRNAs per target list, we identified a total of 67 targets of miR-33, 217 targets of miR-330, 334 targets of miR-181a, and 25 targets of miR-10b (see Supplemental Material, Table 2). [score:13]
We focused a detailed analysis on the four most significantly down-regulated miRNAs, as determined through microarray analysis and qRT-PCR: miR-33, miR-330, miR-181a, and miR-10b. [score:4]
For this analysis, we used a stringent computational matching approach to identify predicted mRNA targets for miR-33, miR-330, miR-181a, and miR-10b. [score:3]
The five most significantly differentially expressed miRNAs, as determined through microarray analysis, were miR-33 (FC = −5.5), miR-450 (FC = −3.6), miR-330 (FC = −2.4), miR-181a (FC = −2.1), and miR-10b (FC = −2.1). [score:3]
For example, miR-33 shows decreased expression levels in tissues from patients with lung carcinomas (Yanaihara et al. 2006). [score:3]
These findings suggest that miR-33, miR-330, and miR-10b may influence cellular disease state specifically related to cancer. [score:3]
qRT-PCR validated the findings of the decreased miRNA expression induced by formaldehyde exposure: FC = −1.3 for miR-330; FC = −7.4 for miR-181a; FC = −1.2 for miR-33; and FC = −1.5 for miR-10b [see Supplemental Material, Figure 1 (doi:10.1289/ehp. [score:3]
The predicted targets of miR-33, miR-330, miR-181a, and miR-10b generated a total of 40 networks [see Supplemental Material, Table 3 (doi:10.1289/ehp. [score:3]
Here, we further investigated the four miRNAs with the most significant formaldehyde -induced changes in expression:miR-33, miR-330, miR-181a, and miR-10b. [score:1]
[1 to 20 of 9 sentences]
23
[+] score: 29
Unexpectedly, we found that miR-33a was down-regulated whereas miR-200a was strongly up-regulated in primary keratinocytes from elderly donors (Figure 5(a)), suggesting that the latter miRNA may be responsible of OGG1-2a down-regulation during skin aging. [score:10]
Computational prediction of OGG1 as target gene of miR-33a and miR-200a was done using published algorithms: TargetScan (http://www. [score:5]
Of note, the miR-33a -mediated down-regulation of OGG1-2a in human and mouse cells resulted in increased 8-OH-dG accumulation, activation of NLRP3 inflammasome, and increased IL-1 β production [31]. [score:4]
However, OGG1 has been found target of miR-4673 [32] and miR-33a [31]. [score:3]
Specifically, computational miRNA target analysis revealed that OGG1-2a has two predicted seed sequences for miR-33a and one seed sequence for miR-200a in its 3′-UTR (Supplemental Figure 1A). [score:3]
In silico analyses indicated that OGG1-2a isoform is a potential target of both miR-33a and miR-200a. [score:3]
Supplemental Figure 1: miR-33a and miR-200a seed sequences on OGG1-2a gene. [score:1]
[1 to 20 of 7 sentences]
24
[+] score: 29
When normal chondrocytes are transfected with a miRNA-33a mimic, MMP-13 expression is increased, whereas, in contrast, levels of ApoA1 drop, although ApoA1 is not a direct miRNA-33a target. [score:6]
Downregulated RCT, critically modulated by miRNA-33a, and deregulated autophagic flux, modulated by miRNA-155, are prominent molecular features of OA. [score:5]
As a matter of fact, miRNA-33a is produced by a nested gene, lying within intron 16 of human SREBP2, and both of these molecules are up-regulated in OA chondrocytes. [score:4]
miRNA-33a and SREBP-2 are subjected to common positive transcriptional regulation by TGF-β1, while miRNA-33a is essential for the TGF-β1 -dependent expression of SREBP-2 itself. [score:4]
miRNA-33a, a key modulator of lipid metabolism [80], is a central player, linking OA pathogenesis with deregulated metabolism. [score:2]
Given the importance of ApoA1 in RCT [81], and the role of MMP-13 in the acquisition of the osteoarthritic phenotype by chondrocytes [82], miRNA-33a emerges as a central player linking OA pathogenesis to deregulated metabolism [34]. [score:2]
Transcription factor sterol regulatory element binding protein 2 (SREBP-2) and miRNA-33a are fundamental in the orchestration of sterol metabolism [79]. [score:2]
Kostopoulou F. Malizos K. N. Papathanasiou I. Tsezou A. MicroRNA-33a regulates cholesterol synthesis and cholesterol efflux-related genes in osteoarthritic chondrocytes Arthritis Res. [score:1]
Certain OA-related miRNAs, i. e., miRNA-33a, miRNA-455-3p, miRNA-140, and miRNA-335-5p, are actually embedded within the intronic regions of human SREBP-2, COL27A1, WWP2, and MEST, respectively. [score:1]
ATP binding cassette subfamily A member 1 (ABCA1), which is implicated in cholesterol efflux, is also decreased by miRNA-33a [34]. [score:1]
Marquart T. J. Allen R. M. Ory D. S. Baldan A. miR-33 links SREBP-2 induction to repression of sterol transporters Proc. [score:1]
[1 to 20 of 11 sentences]
25
[+] score: 27
Other miRNAs from this paper: rno-mir-33, hsa-mir-33b
Regarding mitochondrial β-oxidation, the expression of CPT1A was changed following BDL and CP-MSC transplantation via miR-33, which is known as a posttranscriptional regulator of CPT1A, independent of PPAR α. Decreased cellular ATP production after BDL, which reflects mitochondrial dysfunction, was increased by CP-MSC transplantation via regulation of HO-1 and HO-2. Stem cell therapy with MSCs has been tried for the treatment of various liver diseases, including cirrhosis and hepatic failure, as an alternative to liver transplantation. [score:7]
The expression of miR-33 was normalized to U6 snRNA expression. [score:5]
Therefore, we explored the possibility of posttranscriptional regulation of CPT1A and verified that CPT1A is changed via alternative expression of miR-33 [23]. [score:4]
As expected, we determined that miR-33 expression was reduced in BDL rats and was restored by transplantation of CP-MSCs (Figure 3(e)). [score:3]
Taken together, these results suggest that CPT1A may be regulated posttranscriptionally by miR-33 in a PPAR α-independent manner. [score:2]
MiR-33 represses its target genes, which are involved in free fatty acid oxidation, such as CPT1A [23]. [score:2]
To evaluate whether miR-33 is a posttranscriptional regulator of CPT1A in BDL rat liver, we analyzed the expression levels of miR-33. [score:2]
CPT1A Expression Is Changed via MiR-33 in BDL Rats. [score:2]
[1 to 20 of 8 sentences]
26
[+] score: 27
Interestingly, among the 736 miRNAs analyzed in the first study, upregulation of miR-455-3p and miR-33a was associated with chemosensitivity while upregulation of miR-224, miR-1236, and miR-520d-3p was associated with chemoresistance [21]. [score:7]
Upregulation of miR-455-3p and miR-33a was found to be associated with chemosensitivity while upregulation of miR-224, miR-1236, and miR-520d-3p was associated with chemoresistance [21]. [score:7]
In addition, a predictor score based on a signature of five miRNAs, among which high expression of miR-224, miR-1236, and miR-520d-3p and low expression of miR-455-3p and miR-33a were individually associated with unfavorable outcome, has been proposed to predict the clinical outcome of DLBCL patients, independent from the IPI score [21]. [score:5]
On the other hand, high expression of miR-224, miR-1236, and miR-520d-3p and low expression of miR-455-3p and miR-33a were found to be individually associated with unfavorable outcome and a score based on this five-miRNAs was proposed to predict the clinical outcome of DLBCL patients treated with R-CHOP regimen, independent from the IPI score [21]. [score:5]
Five miRNAs were differentially expressed between both groups (miR-224, miR-1236, miR-520d-3p, miR-33a, and miR-455-3p) and were validated in an independent group of 133 patients. [score:3]
[1 to 20 of 5 sentences]
27
[+] score: 25
Marquart et al. [129] delivered antimiRs intravenously (5 mg/kg/dose on three consecutive days) and showed increased ABCA1 expression and HDL-cholesterol levels in serum 12 days after administration, whereas Najafi-Shoushtari et al. [11] injected a LNA -modified antimiR-33 i. v. at a dose of 20 mg/kg for three consecutive days, which resulted in efficient inhibition of miR-33 and concomitant increase of HDL-C by 25% in the mouse serum. [score:5]
Together, these studies demonstrate that pharmacological inhibition of miR-33 in vivo by antimiR-33 oligonucleotides raises circulating HDL-C levels, enhances reverse cholesterol transport and regresses atherosclerosis, implying that therapeutic silencing of miR-33 could be a useful strategy for the treatment of cardiovascular disease. [score:5]
In 2010, a number of independent studies reported that miR-33a, which is embedded within an intron of the sterol regulatory element -binding protein-2 (SREBP2) gene, targets the ATP -binding cassette transporter A1 (ABCA1), an important regulator of high-density lipoprotein (HDL) synthesis and reverse cholesterol transport, for post-transcriptional repression [11, 12, 129, 139, 140]. [score:5]
More recently, a third in vivo study targeting miR-33 was reported, in which low-density lipoprotein (LDL) receptor knockout mice with established atherosclerotic plaques were treated with s. c. delivered 2'F/MOE antimiR for four weeks (two s. c. injections of 10 mg/kg the first week followed by weekly injections of 10 mg/kg) [108]. [score:4]
The mature sequences of miR-33a and miR-33b differ by only two nucleotides and share the same seed region, implying that the two miR-33 family members have overlapping targets, and, thus, redundant biological functions, including regulation of cholesterol efflux in cells. [score:4]
Interestingly, another member of the miR-33 family, miR-33b, is found within an intron of the SREBP-1c gene in human and primates, whereas mice only have one miR-33 isoform corresponding to miR-33a [11]. [score:1]
Three in vivo studies have used antimiR oligonucleotides to probe the functions of miR-33 in cholesterol homeostasis in the mouse. [score:1]
[1 to 20 of 7 sentences]
28
[+] score: 24
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
Mir-33a/b and miR-122 target AMPK (activated by metabolic stress) and ACC1/2 respectively, whereas miR-205 targets the acyl-CoA synthetase, indirectly regulating the components of carnitine system. [score:7]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) Cancer metabolic plasticity allows tumor cells to survive in the face of adverse environmental conditions. [score:3]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) MicroRNAs are transcribed by RNA polymerases II and III in pri-miRNAs, generating precursors that undergo a series of cleavage events to form mature microRNA. [score:3]
Interestingly, components of cholesterol efflux and fatty acid metabolism are regulated by miR-33a and miR-33b. [score:2]
[1 to 20 of 5 sentences]
29
[+] score: 24
miR-125a-3p inhibits autophagy through targeting UV radiation resistance -associated gene (UVRAG), miR-33 targets ATG5/LAMP1, miR-144-3p targets autophagy-related gene 4a (ATG4a), miR-23a-5p inhibits the TLR2/MyD88/NF-κB leading to reduced autophagy and miR-33 also plays an inhibitory role via targeting some unknown factors. [score:15]
Ouimet et al. (2016) reported that miR-33 induction in THP-1 and HEK293 cells inhibits the integrated pathways involved in autophagy and also reprograms the host lipid metabolism for intracellular survival and persistence of Mtb. [score:3]
miR-125a-3p, miR-33, miR-144-3p, miR-23a-5p, and miR-142-3p are potential inhibitors of autophagy in Mycobacterium tuberculosis (Mtb) infection. [score:3]
Mycobacterium tuberculosis induces the miR-33 locus to reprogram autophagy and host lipid metabolism. [score:1]
1 and primary human macrophages Bettencourt et al., 2013 miR-33 ATG5, LAMP1 Human THP-1 and HEK293 cells Ouimet et al., 2016 miR-125a-3p UVRAG Mouse RAW264.7 and J774A. [score:1]
Ouimet et al. (2016) revealed that silencing of miR-33 and miR-33 [∗] by genetic or pharmacological means promotes autophagy flux through depression of key autophagy effectors and AMPK -dependent activation of the transcription factors FOXO3 and TFEB. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 21
Several miRNAs have been documented to directly inhibit TWIST1, including miR-1-1 [26], miR-33a [27, 28], miR-137 [29], miR-186 [30], miR-300 [31], miR-520d-5p [32], miR-539 [31], miR-543 [31], miR-675 [33], and miR-720 [34]. [score:4]
For example, it was demonstrated that miR-33a is upregulated in chemoresistant osteosarcoma and promotes cell resistance to cisplatin [27]. [score:4]
The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
0168171.g007 Fig 7The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
Interestingly, we found that miR-33a and miR-151 are significantly negative correlated with TWIST1 gene expression in breast cancers (Table 2). [score:3]
Among these miRNAs, the data obtained from TCGA reveal that like miR-151, miR33a and miR-137 are significantly higher expression levels in breast cancers as compared with the paired normal tissues (Fig 7). [score:2]
Most of these miRNAs repressed cancer cell EMT and metastasis in most examined cancer types, and some of them (miR-33a and miR-186) modulated cancer cell sensitivity to cisplatin by down -regulating TWIST1 [27, 30]. [score:2]
[1 to 20 of 7 sentences]
31
[+] score: 19
It was reported that the expressions of miR-33a and miR-33b were independently regulated in that miR-33a expression was controlled by SREBP-2, while miR-33b expression was triggered by LXR [21]. [score:8]
miR-33b is a member of human miR-33 family and has been reported to regulate lipid metabolism and cholesterol homeostasis by targeting the downstream genes. [score:4]
In addition, miR-33a was implicated in mediating anti-apoptotic effect on cisplatin-resistant osteosarcoma by targeting TWIST [49]. [score:3]
miR-33 also binds to 3′UTR of carnitine O-octaniltransferase (CROT), Carnitine palmitoyltransferase 1A (CPT1a) and hydroxyacyl-CoA-dehydrogenase (HADHB) to regulate fatty acid metabolism [47]. [score:2]
miR-33 is co-transcribed with SREBP genes, reducing cholesterol export [21, 46]. [score:1]
A recent study suggests that another membrane of miR-33 family, miR-33a, enhances glioma-initiating cell self-renewal through PKA and NOTCH pathways [48]. [score:1]
[1 to 20 of 6 sentences]
32
[+] score: 19
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
We noticed the miR-33-5p, miR-460a-5p, miR-365b-5p, miR-125b-5p and miR-2954 correlated with inflammatory genes including MEOX2, IL-1BETA, TRAF2, TNFRSF1B and MAP3K8, and except for the up-regulated miR-33-5 correlated with under expression of MEOX2, other down-regulated miRNAs all correlated with overexpression targets. [score:13]
Likewise, from the miRNA-mRNA association, the under expressed genes LZTFL1, JAZF1, THBS2 and RPS14 were associated with microRNAs (miR-146b-5p, miR-1684a-3p, miR-460b-3p, miR-30e-5p, miR-33-5p, miR-148a-5p, miR-32-5p, miR-155 and miR-144-3p) that were down-regulated in pulmonary arteries (Figure 4). [score:6]
[1 to 20 of 2 sentences]
33
[+] score: 19
miRNAs Deregulated in OS Expression Levels Compared to the Controls Overall Function miR-382 Down-regulated Poor survival outcome and metastasis marker[70, 83] miR-154 Down-regulated Poor survival outcome[70] miR-33a Up-regulated Chemoresistance[84] miR-34c Down-regulated Chemoresistance[85] Most forms of human cancer have changes in the epigenome compared to the normal cellular counterparts from which they are derived. [score:14]
Zhou Y. Huang Z. Wu S. Zang X. Liu M. Shi J. miR-33a is up-regulated in chemoresistant osteosarcoma and promotes osteosarcoma cell resistance to cisplatin by down -regulating TWIST J. Exp. [score:5]
[1 to 20 of 2 sentences]
34
[+] score: 17
The three miRNAs miR-33a, 149a, and 193a-3p, which showed changes in expression level after XB130 downregulation, exhibit tumor suppressive function in thyroid cancer cells [38– 40]. [score:8]
Overexpression of miR-33a, 149a, and 193a-3p miRNA specific mimics led to protein level reduction of their corresponding targets Myc, SLC7A5, and FOSL1 [41]. [score:5]
The expression of both the pri-miRNA and mature miRNA of miR-33a, 149a, and 193a-3p was increased in XB130 knockdown WRO cells [41]. [score:4]
[1 to 20 of 3 sentences]
35
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Several independent studies in chicken have similarly indicated that gga-mir-33 and its host gene SREBF2 are highly expressed in the liver, suggesting involvement in expression upregulation of genes related to cholesterol biosynthesis [80], [81]. [score:8]
Out of the 26 miRNA/host gene pairs with coordinated expression, 11 have been found to be coordinately expressed in both, human and mouse [19], [27], [59], [61]– [64], [67]– [69], [71], [73]– [79]: mir-103/ PANK3, mir-107/ PANK1, mir-126/ EGFL7, mir-128-1/ R3HDM1, mir-140/ WWP2, mir-211/ TRPM1, mir-218-1/ SLIT2, mir-218-2/ SLIT3, mir-27b/ C9orf3, mir-33/ SREBF2, and mir-499/ MYH7B. [score:5]
Moreover, two miRNA/host gene pairs have been found to have expression patterns associated with the same phenotype in both species: mir-499/ MYH7B with heart development [79] and mir-33/ SREBF2 with cholesterol homeostasis [74], [75], [77]. [score:4]
[1 to 20 of 3 sentences]
36
[+] score: 17
Although a trend toward the overexpression of miR-33, miR-34 and miR-92a was observed, no evidence for a statistically significant difference in miRNA expression at this early stage of the disease was found. [score:7]
A trend to an increase in miR-33-5p and -92a-5p levels and a decrease in miR-375-3p - Illumina Hi-Seq 2000, small RNAs from fly heads Drosophila mo dels: UAS-Atxn7-102Q and UAS-Atxn7-10Q[56] A study on SCA1 was the first to reveal that some miRNAs can regulate the expression of target transcript mRNA containing a CAG repeat expansion. [score:6]
The study conducted at the beginning of the pathological process revealed a trend toward a decrease in miR-1 and an increase in miR-33, miR-92a and miR-100 levels, however, the observed changes in miRNA expression were not statistically significant. [score:3]
In the case of SCA7 the level of miR-33 and miR-92 tended to be higher and the level of miR-375 was found to be lower but these differences were not statistically significant. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 15
Other miRNAs from this paper: mmu-mir-33, hsa-mir-33b
Moreover, our data clearly show a reduction in the activity of promoter constructs derived from the 5′ untranslated region of ABCA1 (Fig. 5), whereas miR-33 targets the 3′ untranslated region of ABCA1 (49). [score:7]
Accordingly, we analyzed miR-33 expression after ER stress induction. [score:3]
miR-33 expression was unaltered by thapsigargin treatment in HepG2 cells (data not shown). [score:3]
Rayner K. J. Suarez Y. Davalos A. Parathath S. Fitzgerald M. L. Tamehiro N. Fisher E. A. Moore K. J. Fernandez-Hernando C. 2010 MiR-33 contributes to the regulation of cholesterol homeostasis. [score:1]
This finding further suggests that miR-33 does not play a major role in the repression of ABCA1 under ER stress. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 15
Expression (number of molecules of the target gene/number of molecules of the housekeeping gene) of the intronic miRNAs A) miR-140-5p, B) miR-140-3p, and C) their host gene WWP2, of D) miR-33a and E) its host gene SREBF2, of F) miR-151 and G) its host gene PTK2/FAK in human normal (n = 6) and osteoarthritic (OA) (n = 6) chondrocytes. [score:5]
The expression levels of miR-33a (Figure  1D) and its host gene SREBF2 (Figure  1E) were similar in normal and OA chondrocytes; however, the expression level of miR-151 (Figure  1F) was significantly decreased compared to that of its host gene PTK2/FAK (Figure  1G). [score:4]
Subsequent experiments were done using primers located in exons 4 and 5. To determine whether the differential expression level between WWP2 and miR-140 was due to a different miRNA processing in OA cells, we determined the levels of two unrelated intronic miRNAs: miR-33a (Figure  1D) present in one intron of the sterol regulatory element binding factor-2 (SREBF2) gene and miR-151 (Figure  1F), present in one intron of the protein tyrosine kinase or focal adhesion kinase (PTK2/FAK) gene. [score:3]
Subsequent experiments were done using primers located in exons 4 and 5. To determine whether the differential expression level between WWP2 and miR-140 was due to a different miRNA processing in OA cells, we determined the levels of two unrelated intronic miRNAs: miR-33a (Figure  1D) present in one intron of the sterol regulatory element binding factor-2 (SREBF2) gene and miR-151 (Figure  1F), present in one intron of the protein tyrosine kinase or focal adhesion kinase (PTK2/FAK) gene. [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 15
Human miR-33 has two isoforms, has-miR-33a and has-miR-33b, which share the same seed sequence, have the same predicted targets, and are both regulating lipid and cholesterol metabolism [19, 52]. [score:4]
Hsa-miR-1233-3p (a), hsa-miR-140-3p (b), hsa-miR-150-5p (c), hsa-miR-33-3p (d), hsa-miR-4284 (e), hsa-miR-663a (f), and hsa-miR-671-3p (g) manifested an area under the curve (AUC) value > 0.8 (AUC > 0.8) and p < 0.01 We verified by qRT-PCR the expression levels of the seven selected miRNAs (hsa-miR-33b-3p, hsa-miR-4284, hsa-miR-663a, hsa-miR-150-5p, hsa-miR-1233-3p, hsa-miR-140-3p, and hsa-miR-671-3p) in all serum samples. [score:3]
No significant differences were observed for hsa-miR-33-3p, hsa-miR-4284, hsa-miR-663a, and hsa-miR-1233-3p expression levels between OA and healthy articular cartilage. [score:3]
Recently, miR-33b was shown to regulate adipocyte differentiation [54] and miR-33a different functions of macrophages having a role in development and progress of atherosclerosis [55]. [score:3]
Our group has highlighted the role of hsa-miR-33a in regulating cholesterol transport genes [53]. [score:2]
[1 to 20 of 5 sentences]
40
[+] score: 14
Previous functional studies have shown that miR33a regulates expression of genes in cellular pathways of cholesterol transport, including ABCA1 (ATP binding cassette transporter) and the lysosomal transporter protein NPC1 (Niemann-Pick disease, type C1) [39]– [40]. [score:6]
This microRNA is co-expressed with SREBP2 in many different tissues including placenta, indicating that miR33a may be a global regulator of cholesterol transport and metabolism [39]. [score:4]
Interestingly, rs1053989 disrupts the miR33a “seed” sequence (CAATA C/A A) that must be perfectly complementary for binding of microRNAs with recognition sites in 3′ UTRs of targeted genes. [score:3]
SNP rs1053989 alters a putative binding site for microRNA miR33a in the 3′ UTR of CRH-BP (exon 7) (CAAAGCAACGTGCAATA C/A AA) [38]. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 13
For the latent stage, 18 consistently differentially expressed mature miRNA sequences were identified: 8 were up-regulated (miR-212-3p, miR-21-5p, miR-132-3p, miR-20a-5p, miR-17-5p, miR-27a-3p, miR-23a-3p, miR-146a-5p) and 10 were down-regulated (miR-139-5p, miR-551b-3p, miR-33-5p, miR-708-5p, miR-7a-5p, miR-935, miR-138-5p, miR-187-3p, miR-30e-3p, miR-222-3p) (Table  2). [score:9]
The most common down-regulated miRNAs were miR-30a-5p (6 profiles), followed by miR-139-5p, miR-187-3p, miR-551b-3p, miR-140-3p, miR-324-5p, miR-33-5p, miR-218-5p, miR-378a-3p and miR-29c-5p (Supplementary Table  S4). [score:4]
[1 to 20 of 2 sentences]
42
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
A detailed analysis was made on the four most significantly down-regulated miRNAs, namely miR-33, miR-330, miR-181a, and miR-10b, as determined through microarray analysis and qRT-PCR. [score:4]
A stringent computational matching approach was used to identify predicted mRNA targets for miR-33, miR-330, miR-181a, and miR-10b. [score:3]
These findings suggest that miR-33, miR-330, and miR-10b may influence cellular disease state, specifically related to cancer. [score:3]
For example, the expression level of miR-33 is decreased in tissues from patients with lung carcinoma (Yanaihara et al., 2006). [score:3]
[1 to 20 of 4 sentences]
43
[+] score: 13
Among CREB1-controlled STPs we found SREBP2 (TF target) and miR-33a (Intragenic microRNA) that are known to be co-regulated [44] and we previously demonstrated to be downregulated by miR-214 [45]. [score:7]
Very recently, Zhou and colleagues demonstrated miR-33a tumor suppressive role in melanoma, thus suggesting a potential additional effect of miR-214 in promoting melanoma malignancy via the downregulation of another miRNA, miR-33a [46]. [score:6]
[1 to 20 of 2 sentences]
44
[+] score: 12
Other miRNAs from this paper: hsa-mir-33b
Knocking down miR-33 in primary chicken hepatocytes increased the expression of FTO [56]. [score:4]
Furthermore, miR-33 was shown to regulate FTO expression. [score:4]
miR-33 is expressed in many tissues in the chicken, including adipose tissue. [score:3]
miR-33 is transcribed from an intronic region within SREBF2. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 12
For the pre-miR-33a:AL-33a and pre-miR-210:AL-210 pairs, very effective inhibition was observed, even at a low concentration of the oligomer (Fig. 3B). [score:3]
Our previous experiments demonstrated that ATD_13.6 efficiently inhibits pre-miR-210 cleavage and only slightly affects pre-miR-33a processing (Fig. 1A). [score:3]
The obtained results revealed that AL-33a and AL-210 formed stable complexes with pre-miR-33a and pre-miR210, respectively. [score:1]
A different effect was observed for two other examined pairs, pre-miR-33a/AL-33a and pre-miR-210/AL-210. [score:1]
The results of the experiments performed for four pairs, 2OMe-AL-16-1_2:pre-miR-16, 2OMe-AL-21:pre-miR-21, 2OMe-AL-33a:pre-miR-33a, and 2OMe-AL-210:pre-miR-210, are shown (Fig. 6). [score:1]
0077703.g001 Figure 1(A) Radiolabeled pre-miR-210 or pre-miR-33a was incubated with hDicer in the presence of ATD_13.6. [score:1]
To determine whether these observations are specific cases of a more general rule, we tested the effects of four 12-nt oligomers, AL-16-1, AL-21, AL-33a and AL-210, on pre-miR-16-1, pre-miR-21, pre-miR-33a and pre-miR-210 processing. [score:1]
0077703.g003 Figure 3(A) The predicted secondary structures of four tested pre-miRNAs (pre-miR-16-1, pre-miR-21, pre-miR-33a and pre-miR-210). [score:1]
[1 to 20 of 8 sentences]
46
[+] score: 11
Other miRNAs from this paper: hsa-mir-145, rno-mir-33, rno-mir-145, hsa-mir-33b
As shown in Fig. 2c, miR-33-3p expression was increased (x1.4-fold, p < 0.05), whereas the expression of miR-145-3p and 7-1-5p was reduced (x0.65-0.68-fold, p < 0.0001). [score:5]
Besides observing that same increment in mTOR activity within this study, we show an increase in miR-33-3p as a new mechanism contributing to fructose reduction of hepatic IRS2 expression 40. [score:3]
To our knowledge, this is the first report on the modulation of miRNA-33 by fructose ingestion, although dietary glycaemic load, and specifically diet supplementation with liquid fructose, can alter the miRNA liver expression profile 41 42. [score:3]
[1 to 20 of 3 sentences]
47
[+] score: 11
Liang C Yu XJ Guo XZ Sun MH Wang Z Song Y Ni QX Li HY Mukaida N Li YY MicroRNA-33a -mediated downregulation of Pim-3 kinase expression renders human pancreatic cancer cells sensitivity to gemcitabineOncotarget. [score:7]
By contrast, Liang et al. demonstrated that miR-33a is capable to increase the sensitivity of pancreatic cancer cells to GEM through the down-regulation of pro-oncogenic AKT/Gsk-3β/β-catenin signaling pathway [158]. [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
One of the most significant predicted gene targets of miR-33 is ABCA1, which produces cholesterol efflux regulatory protein (CERP). [score:4]
miR-33 also targets ABCG1, which reduces the efflux of cholesterol to high-density lipoprotein (HDL) and serum in macrophages [156, 161]. [score:3]
For example, miR-33 has been shown to regulate cholesterol homeostasis at the cellular level [158, 159]. [score:2]
The known lipid regulatory microRNAs are few and include amongst others miR-335, miR-33, miR-122, miR-370, miR-378-3p, and miR-125a-5p [157]. [score:2]
[1 to 20 of 4 sentences]
49
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
With exception of miR-33a, miR223, miR-9, miR-24, and miR-429, whose expression level was low in activated B cells, such Prdm1 -targeting miRNAs were significantly upregulated by HDI. [score:8]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
As mentioned above, the host gene of mir-33a, SREBF2, is known to regulate the expression of several lipogenic enzymes in numerous tissues involving the mammary gland, and plays a key role in controlling cholesterol homeostasis [70]. [score:4]
Intragenic mir-33a and the host gene SREBF2 may act in a coordinated manner to govern lipid metabolism [69], their presence in QTL associated with milk fat content possibly revealing a role for this cooperation in the regulation of milk fatty acid traits. [score:2]
Another example is mir-33a, which may act in concert with its SREBF2 host genes to govern intracellular function and cholesterol homeostasis in vertebrates, thus representing an example of miRNA-host gene cooperation in regulating a metabolic pathway [69]. [score:2]
Among these, 16 precursors were found amongst the 43 conserved between human, mouse, cow and goat in our analysis (let-7 g, mir-101-2, mir-103, mir-107, mir-128-1, mir-1306, mir-140, mir-15b, mir-16b, mir-211, mir-218-1, mir-26a-1, mir-32, mir-33a, mir-455, let-7-2), so the location of these precursors appears to be highly conserved in all vertebrates. [score:1]
Finally, an intragenic miRNA, mir-33a, was also localized in a QTL linked to milk fat content. [score:1]
[1 to 20 of 5 sentences]
51
[+] score: 10
We discovered that of these five miRNAs, miR-122 and miR-192 were upregulated at least 1.5-fold in both HES1 and HES2 cells, while miR-135b and miR-33a were upregulated only in HES2 cells, and miR-224 was upregulated only in HES1 cells. [score:10]
[1 to 20 of 1 sentences]
52
[+] score: 10
Inhibition of miR-33a up-regulates Twist1 expression and enhances cisplatin -induced apoptosis [122]. [score:8]
Consistently, a subsequent study found that miR-33a promotes osteosarcoma cell resistance to cisplatin by down -regulating Twist1. [score:2]
[1 to 20 of 2 sentences]
53
[+] score: 10
MiR-205 over -expression leads to an expansion of the progenitor-cell population and increased cellular proliferation [26], while miR-27 reduces lipid accumulation by targeting peroxisome proliferator-activated receptor γ (PPARγ) in human adipocyte cells [27], and miR-33 represses sterol transporters in human liver cells [28]. [score:5]
For example, miR-33, which is a sense oriented intronic miRNA in the sterol regulatory element -binding protein (SREBP), is co-regulated with SREBP and is capable of targeting ATP -binding cassette sub -family G (ABCG1) [52] which is downstream of SREBP [53]. [score:5]
[1 to 20 of 2 sentences]
54
[+] score: 9
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
The following miRNAs were tested for their potential to repress Twist1 translation in the human lung carcinoma cell line H1299: miR-33, miR-145a, miR-151, miR-326, miR-337, miR-361, miR-378a, miR-381, miR-409 and miR-543 (Fig. 1). [score:3]
The miRBase accession numbers for miRNAs are: mmu-miR-33 (MI0000707), mmu-miR-145a (MI0000169), mmu-miR-151 (MI0000173), mmu-miR-326 (MI0000598), mmu-miR-337 (MI0000615), mmu-miR-361 (MI0000761), mmu-miR-378a (MI0000795), mmu-miR-381 (MI0000798), mmu-miR-409 (MI0001160) and mmu-miR-543 (MI0003519). [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Chronic alcohol feeding of mice showed upregulation of miR-33, miR-34a, and miR-217 in the liver and these microRNAs were also elevated in ethanol-exposed mouse AML-12 hepatocytes. [score:4]
Importantly, ethanol feeding increased miR-33 expression and decreased VLDL secretion [4, 79]. [score:3]
Allen R. M. Marquart T. J. Jesse J. J. Baldan A. Control of very low-density lipoprotein secretion by N-ethylmaleimide-sensitive factor and miR-33 Circ. [score:1]
In ethanol fed mice, miR-33 and miR-34a were also increased, though not in cultured cells [74]. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 9
The up-regulation of miR-210, miR-21 and miR-155 as well as down-regulation of let-7i and miR-33a, were among those that were predicted to target mRNAs associated with transcriptional activity leading to enhanced cell proliferation, survival and migration as well as a decrease in growth arrest and apoptosis (Bruning et al., 2011; Clark et al., 2014). [score:9]
[1 to 20 of 1 sentences]
57
[+] score: 9
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-33b
However, miR-33 can downregulate p53 by directly binding to the p53 3′UTR to promote self-renewal in murine hematopoietic stem cells 46. [score:5]
Interestingly, a recent report demonstrated that miR-33a, another member of the miR-33 family, promotes the self-renewal of glioma-initiating cells 38. [score:1]
Bioluminescence imaging showed that mice bearing the 4T1/ctrl cells formed multiple large metastases, while 4T1/mmu-miR-33 cells displayed relatively weak metastasis both in orthotopic implantation and tail vein injection (Fig. 7B,C). [score:1]
We used highly metastatic mouse breast cancer cells 4T1 to generate luciferase-labeled 4T1/ctrl and 4T1/mmu-miR-33 cells (Supplementary Fig. 6) and injected them into the orthotopic site or tail vein of mice. [score:1]
Mice injected with 4T1/ctrl cells at the mammary fat pad formed tumors with a larger size and a higher weight than mice injected with 4T1/mmu-miR-33 cells at the orthotopic site (Fig. 7A). [score:1]
[1 to 20 of 5 sentences]
58
[+] score: 9
Phylogenetic analysis, target gene prediction and pathway analysis showed that, among the 13 conserved miRNAs (miR-1, miR-100, miR-10a, miR-124, miR-125, miR-184, miR-33, miR-34, miR-7, miR-9, miR-92a, miR-92b and miR-let7), several highly conserved miRNAs (miR-1, miR-7 and miR-34) targeted the same or similar genes leading to the same pathways in shrimp, fruit fly and human (Figure 3b). [score:5]
Six miRNAs (miR-279, miR-33, miR-79, miR-9, miR-S5 and miR-S12) were significantly down-regulated by more than twofold. [score:4]
[1 to 20 of 2 sentences]
59
[+] score: 9
Figure 7(B) shows a heatmap of the expression of the enzymes involved in cholesterol biosynthesis and Figure 7(C) shows the expression of miR-33, a miRNA linked to cholesterol homeostasis [55], [56]. [score:5]
The cholesterol sensitive miRNA-33a shows a similar expression pattern (C) to the main cluster. [score:3]
In the latter case, the evidence for a role comes from apparently highly coordinated changes in the levels of cholesterol producing enzymes as well as other genes involved in cholesterol homeostasis, such as the miRNA mir-33. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 9
These findings are consistent with previous studies that indicate miR-33a is highly expressed in low sterol condition whereas miR-33b is more abundant in cholesterol-filled cells [50]. [score:3]
Although miR-33a/b were not differentially expressed in response to the HCHF challenge diet both miRNAs were detected in low and high LDL-C livers, however, at differing amplitudes. [score:3]
miR-33 family is transcribed from the introns of sterol-regulatory element -binding factor (SREBF) isoforms and is linked to cholesterol homeostasis [51]. [score:2]
miR-33a was more abundant in low LDL-C while miR-33b was more abundant in high LDL-C livers. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 9
miR-16, miR-31, miR-33a, miR-146a, miR-155, and miR-301a can suppress or promote IL-8 expression and secretion by inhibiting the expression of different proteins [31– 36]. [score:9]
[1 to 20 of 1 sentences]
62
[+] score: 9
Hsa-miR-942 was an up-regulated, while hsa-miR-33a was a down-regulated miRNAs in ovarian cancer. [score:7]
The miRNA pair of hsa-miR-942 and hsa-miR-33a had the highest function module number of 279, and hsa-miR-942 as a hub node in MFSN, was synergistic with 31 miRNAs. [score:1]
The miRNA pairs comprised of hsa-miR-33a and hsa-miR-942 accounted for the richest functional module number of 279. [score:1]
[1 to 20 of 3 sentences]
63
[+] score: 9
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
Also miR-33 expression was found to be strongly associated with the genomic alteration [128]. [score:3]
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
[1 to 20 of 3 sentences]
64
[+] score: 8
Insulin did not significantly change expression of miR33a, miR144, miR181a, miR181b, miR181c, or miR181d in the T24 cells. [score:3]
Next, we wanted to determine if miR33a, miR144, miR181a, miR181b, miR181c, or miR181d changed during a scratch assay and if this affected the human GRβ or GRα expression. [score:2]
Interestingly, miR33a, miR144, miR181a, miR181b, miR181c, and miR181d were all increased in the T24 cells. [score:1]
Three miRNAs were predicted to bind the 3′UTR of human GRβ (miR33a, miR181-a/b/c/d, and miR144). [score:1]
The T24 and UMUC-3 bladder cancer cells were transfected with the 3′UTR GRβ-Luc expression construct with mutation in the miRNA binding site for miR181, miR144, or miR33a and was measured by a luciferase assay, and normalized to renilla (B). [score:1]
[1 to 20 of 5 sentences]
65
[+] score: 8
In human osteosarcoma cells, DANCR could upregulate AXL expression via miR-33a-5p inhibition [43]. [score:8]
[1 to 20 of 1 sentences]
66
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Inhibition of miR-33 in non-human primates resulted in elevated plasma HDL and protective effects against atherosclerosis. [score:3]
However, recent studies suggest that miR-33 inhibition may have adverse effects on lipid and insulin metabolism in mice [132]. [score:3]
Other miRNAs, such as miR-27b, miR-33, miR-34, miR-103, miR-104, 223, and miR-370, also control the fatty acid metabolism and cholesterol biosynthesis in the liver. [score:1]
MiR-33-3p regulates cholesterol and lipid metabolism as well as fatty acid oxidation [131]. [score:1]
[1 to 20 of 4 sentences]
67
[+] score: 7
The expression profile of infected and uninfected cells was evaluated using a miRNA microarray, and 16 miRNAs were reported to be up-regulated (miR-4290, miR-4279, miR-625*, miR-let-7e, miR-1290, miR-33a, miR-3686, miR-378, miR-1246, miR-767-5p, miR-320c, miR-720, miR-491-3p, miR-3647, miR-451 and miR-4286) and 4 down-regulated (miR-106b, miR-20a, miR-30b and miR-3653) during dengue infection. [score:7]
[1 to 20 of 1 sentences]
68
[+] score: 7
Other miRNAs from this paper: hsa-mir-33b
This mechanism involves microRNA-33 (Mir-33), resulting in increased expression of srebf2 and downregulation of ABCA1 59, 60. [score:6]
However, species related differences, between mouse and human, in the role of Mir-33 in the regulation of cholesterol homeostasis have been documented [60], and could account for the differential findings. [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 7
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3
This critical function of mir-33a was dependent upon its direct regulation of PDE8A and UV Radiation Resistance Associated Gene (UVRAG) and their downstream mediators, PKE, and Notch, respectively (Wang et al., 2014). [score:3]
In GBM, mir-33a expression has a negative prognostic effect and is necessary for maintenance and self-renewal of the tumor-initiating cell population. [score:3]
miR-33a promotes glioma-initiating cell self-renewal via PKA and NOTCH pathways. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 7
Similarly, systemic injection of PEI-complexed miR-33a was validated as a novel therapeutic targeting method for Pim-1, with anti-tumor effects comparable to PEI/siRNA -mediated direct in vivo knockdown of Pim-1 in the mo del. [score:5]
These findings demonstrate that chemically unmodified miRNAs complexed with PEI can be used in an efficient and biocompatible strategy of miRNA replacement therapy, as illustrated by efficacious delivery of PEI/miR-145 and PEI/miR-33a complexes in colon carcinoma [131]. [score:1]
After systemic or local application of low molecular weight PEI/miRNA complexes, intact miR-145 and miR-33 molecules were delivered into mouse xenograft tumors where they caused profound anti-tumor effects. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 7
For instance, miR-33a was found to be upregulated in chemoresistant OS and to promote resistance to cisplatin by downregulating TWIST [19]. [score:7]
[1 to 20 of 1 sentences]
72
[+] score: 7
It has been shown that TTF-1 repressed HMGA2 expression, directly and indirectly, by inducing the expression of miR-33a, which in turn affects HMGA2 mRNA. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
As mentioned above, SIRT -targeting miRNAs were found to be crucial for the regulation of adipogenesis and determination of MSCs differentiation towards preadipocytes (e. g., miR-34a, miR-22, miR-93, miR-146b, miR-181a) as well as lipid metabolism (miR-33, miR-34a), insulin secretion (miR-15b) and sensitivity (miR-125a), and their expression profile differs between tissues obtained from obese and normal-weight individuals [26, 41, 44, 53, 85, 86, 87, 88]. [score:6]
Hepatic-specific disruption of SIRT6 by miR-33 in mice results in enhanced glycolysis and triglyceride synthesis causing liver steatosis and correlates with increased triglyceride content observed in human hepatic cell lines, transfected with miR-33 [44]. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 7
Other miRNAs from this paper: hsa-mir-224, hsa-mir-145, hsa-mir-126
Du M MiR-33a suppresses proliferation of NSCLC cells via targeting METTL3 mRNABiochem. [score:4]
Another study found that miR-33a attenuated non-small-cell lung cancer (NSCLC) cell proliferation via targeting the 3ʹ UTR of METTL3 mRNA [74]. [score:3]
[1 to 20 of 2 sentences]
75
[+] score: 7
The expression pattern of miR-23a and miR-33 exhibited an antagonistic relationship. [score:3]
To address this, expression of mature and pre-miRs of miR-489 and miR-630 (from HOK) and miR-23a, miR-33a, miR-155, miR-489, and miR-943 (from Mφ) was examined. [score:3]
However, pre- and mature miRNAs levels of miR-23a and miR-33a did not corroborate. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 6
Shown in this figure, miR-125a-5p exhibited the highest degree, followed by miR-33a-5p,miR-33b-5p,miR-580-3p,miR-499a-5p and miR-34b-3p In the present study, we employed high-throughput circRNA microarrays to construct profiles of differentially expressed circRNAs in CD28 -associated CD8(+)T cells in the elderly and adult subjects (C1,C2,C3 and C4). [score:3]
Shown in this figure, miR-125a-5p exhibited the highest degree, followed by miR-33a-5p,miR-33b-5p,miR-580-3p,miR-499a-5p and miR-34b-3p In the present study, we employed high-throughput circRNA microarrays to construct profiles of differentially expressed circRNAs in CD28 -associated CD8(+)T cells in the elderly and adult subjects (C1,C2,C3 and C4). [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 6
In nonhuman primates, inhibition of miR-33a and miR-33b by an anti-miRNA oligonucleotide increased hepatic expression of ABCA1, a key regulator of high density lipoprotein (HDL) biogenesis, and induced a sustained increase in plasma HDL levels over 12 weeks, with reduction of very low density lipoprotein (VLDL) levels [56]. [score:6]
[1 to 20 of 1 sentences]
78
[+] score: 6
In the case of Drosophila mo dels particular attention should be brought to the two members of conserved mir family, mir-33, and mir-92a, that show trend toward overexpression in some mo dels, albeit not statistically significant at this early time point. [score:3]
However, when we looked more closely to the miRNAs from Table 1 corresponding to conserved miRNA families, we noticed a trend to overexpression of mir-33 and mir-92a in all ataxia mo dels (Table 2), although the statistical significance is below threshold in independent analysis. [score:3]
[1 to 20 of 2 sentences]
79
[+] score: 6
Because we happened to measure 4 other miRNAs among the 16 miRNA biomarkers reported by Wan et al. (miR-30a-5p, miR-33a-5p, miR-139-5p, and miR-451a), we further examined the levels of these miRNAs in subject #7. Interestingly, all 4 miRNAs showed the same up- or down-regulation expression pattern as reported by Wan et al. Therefore, it is tempting to speculate whether emotional status of subject #7 affected the miRNA expression level in CSF. [score:6]
[1 to 20 of 1 sentences]
80
[+] score: 6
In addition, several miRNAs clearly have a role in metabolic pathways for example, miR-33a/b inhibition in nonhuman primates raises plasma HDL cholesterol and lowers triglycerides [9], and silencing of miR103/107 seems to have beneficial effects on insulin sensitivity in obese mice possibly through its target gene caveolin-1 which is a critical regulator of the insulin receptor [10]. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
No miRNA has yet been identified in AD that appears “ de novo” with the initiation or onset of the disease, in contrast to certain cancer -associated miRNAs such as miRNA-10b or miRNA-33 that appear to be previously silent or quiescent and subsequently are “ super-activated,” i. e., up-regulated from zero-abundance, such as is seen in malignant glioblastoma brain tumors and the onset of gliomagenesis [(Gabriely et al., 2011; Teplyuk et al., 2012; unpublished data); AM Krichevsky, personal communication]. [score:6]
[1 to 20 of 1 sentences]
82
[+] score: 6
Other miRNAs from this paper: hsa-mir-155, hsa-mir-33b
In particular, Mtb can block autophagosome maturation to create a replication niche; Mtb upregulates miR-155 in an ESAT6 -dependent manner to avoid elimination and to promote infection in macrophages (43), and Mtb also induces miR-33 to inhibit autophagy and to reprogram the host lipid metabolism to enable its intracellular survival (44). [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
Other miRNAs from this paper: hsa-mir-33b
A possible link between cholesterol and the cell cycle was suggested by Cirera-Salinas et al. [46], who showed that the microRNA miR-33, which regulates the expression of genes involved in fatty acid and cholesterol metabolism [47], also modulates expression of the genes encoding cdk6 and cyclin D1. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
miR-92 and miR-33 were reported to be down-regulated in the plasma of patients with bladder cancer and the expression of these two miRNAs was inversely correlated with the clinical stage of the cancer [22]. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Various studies also reported the differential expression of miRNAs in patients with hepatocellular carcinoma, including miR-135a, miR-33a, miR-320a, miR-122, and miR-31 [10– 14]. [score:3]
Differential expression of microRNAs in patients with hepatocellular carcinoma was reported in numerous studies, such as miR-135a, miR-33a, miR-320a, miR-122, and miR-31 [10– 14]. [score:3]
[1 to 20 of 2 sentences]
86
[+] score: 6
Other miRNAs from this paper: hsa-mir-221, hsa-mir-184, hsa-mir-361, hsa-mir-33b
Both SREBF2 and SREBF1 encode microRNAs, miR-33a and miR-33b respectively, and the coordinate expression of the corresponding SREBP/miRNA represents a mechanism to regulate the expression of the genes responsible of cholesterol homeostasis maintenance [56]. [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
Jiang N LncRNA DANCR promotes tumor progression and cancer stemness features in osteosarcoma by upregulating AXL via miR-33a-5p inhibitionCancer Lett. [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
In a review, Gramantieri et al. (2008) show miRNAs aberrantly expressed in HCC compared to non-tumorous liver tissue (up -expression of miR-33, miR-130, miR-135a, miR-210, miR-213, miR-222, miR-331, miR-373, miR-376a, and down -expression of miR-130a, miR-132, miR-136, miR-139, miR-143, miR-145, miR-150, miR-200a, miR-200b, miR-214). [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 5
For miR-33 and miR-320, we found strong associations between miRNA expression and genomic alterations (p < 0.001), suggesting chromosomal change is a possible mechanism for mis -expression of these genes in primary human breast cancers. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
Silencing of miR-33 in vivo increases hepatic expression of ABCA1 and SREBP-2 [26, 27], leading to dysregulation of cholesterol homeostasis. [score:4]
Thus, miR-33 is critical to maintain normal cholesterol metabolism. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 5
The strongest signal of overlap we identified was for a variant (rs3802177) within the 3′ UTR of the SLC30A8 gene, which maps to miRanda predicted target sites for six islet-expressed miRNAs (miR-363-3p, miR-25-3p, miR-32-5p, miR-92a-3p, miR-33a-5p, and miR-33b-5p) and reaches genome wide significance in T2D-association studies [11]. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
Zhou Y Huang Z Wu S Zang X Liu M Shi J miR-33a is up-regulated in chemoresistant osteosarcoma and promotes osteosarcoma cell resistance to cisplatin by down -regulating TWISTJ. [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Other miRNAs from this paper: hsa-let-7c, hsa-mir-223, hsa-mir-33b
Protein/gene Genetic manipulation Effect on macrophage polarization ReferenceIRF5/ Irf5 KO and conditional LysM-Cre KO ↓↓ M1(14, 15)JUNB/ JunB Conditional LysM-Cre KO(16)KLF4/ Klf4 Conditional LysM-Cre KO ↑ M1/↓ M2(17)TSC1/ Tsc1 Conditional LysM-Cre KO(18)DAB2/ Dab2 Conditional LysM-Cre KO(19) let-7c (mIR) Knockdown and overexpression(20)mIR-223/ mir223 KO(21)Rictor/ Rictor Conditional LysM-Cre KO ↑↑ M1(22)AKT1/ Akt1 KO(23)IL4RA/ Il4ra KO and conditional LysM-Cre KO ↓↓ M2(24, 25)HCK/ Hck KO and knockdown(26, 27)STAT6/ Stat6 KO(28)IRF4/ Irf4 KO(29)PPARy/ Pparg KO(30)JMJD3/ Jmjd3 KO(29)P50/P105/ NfKb KO(31)PI3Kγ/ Pi3kγ KO(32)KLF6/ Klf6 Conditional LysM-Cre KO ↑ M2/↓M1(33)mIR-33/ Mir33 KO(34)MyD88/ myD88 KO(35)AKT2/ Akt2 KO ↑↑ M2(23)SHIP/ Inpp5d KO(36)SHP-2/ Ptpm6 KO(37)p16 INK4a/ Cdkn2a KO(38)TNFR1/ Tnfrsf1a KO(35)TNF/ Tnf KO(35, 39) The current classification of CAM or M1 macrophages is in part based on their response to stimulation with bacterial LPS, TNFα, and/or IFNγ (Table 1). [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
Such case was also proved by the expression level of miR-33a which is usually expressed followed with SREBP-2 [35– 39], as miR-33a was in low copy number (<20, data not show in the paper). [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 4
Other microRNAs that regulate the insulin signaling pathway are miR-33, miR-103, miR-107 and miR-29 [99, 104, 105]. [score:2]
Davalos A. Goedeke L. Smibert P. Ramirez C. M. Warrier N. P. Andreo U. Cirera-Salinas D. Rayner K. Suresh U. Pastor-Pareja J. C. miR-33a/b contribute to the regulation of fatty acid metabolism and insulin signalingProc. [score:2]
[1 to 20 of 2 sentences]
96
[+] score: 4
Conversely, among down-regulated miRNAs common to all three aberrations, miR-33a, miR-29c and miR-219-5p showed the highest fold changes. [score:4]
[1 to 20 of 1 sentences]
97
[+] score: 4
Conversely, miR-33a-5p and miR-711 were expressed at very low levels with Cq values higher than 35 cycles and, consequently, array results were not confirmed for these miRNAs. [score:3]
The levels of miR-33a-5p and miR-711 in primary human MSC were undetectable by RT-qPCR. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 4
Hu Y. Jiang L. Lai W. Qin Y. Zhang T. Wang S. Ye X. MicroRNA-33a disturbs influenza A virus replication by targeting ARCN1 and inhibiting viral ribonucleoprotein activity J. Gen. [score:4]
[1 to 20 of 1 sentences]
99
[+] score: 4
Also, miR-33, which is encoded by an intron within sterol regulatory element -binding protein 2 (SREBP2), the dominant sterol regulatory element binding protein supporting cholesterol synthesis and uptake, acts in concert with its host gene (SREBP2) to control cholesterol homeostasis by regulating cholesterol efflux [33]. [score:4]
[1 to 20 of 1 sentences]
100
[+] score: 4
Expression of β− c a t e n i n can be regulated by microRNA-33a which results in lung cancer cell proliferation [15]. [score:4]
[1 to 20 of 1 sentences]